Update RNA-seq single-end workflow #580

pavanvidem · 2024-10-22T16:17:59Z

No description provided.

github-actions · 2024-10-28T19:04:20Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ rnaseq-sr.ga_0

Problems:

Output with path /tmp/tmpsk5x1h7k/MultiQC Stats table__4e99ac96-4d3e-4753-ae5e-a68bbf8596ee different than expected
Expected text matching expression 'SRR5085167	0.11[0-9]*	18.14[0-9]*	69.79[0-9]*	0.37[0-9]*	0.35[0-9]*	94.81	0.12[0-9]*	34.32	0.22[0-9]*	37.78[0-9]*	36.33[0-9]*	46.0	75.0	75	27.27[0-9]*	0.39[0-9]*' in output ('Sample	featureCounts_mqc_generalstats_featurecounts_Assigned	featureCounts_mqc_generalstats_featurecounts_percent_assigned	Picard: Mark Duplicates_mqc_generalstats_picard_mark_duplicates_PERCENT_DUPLICATION	STAR_mqc_generalstats_star_total_reads_1	STAR_mqc_generalstats_star_mapped_1	STAR_mqc_generalstats_star_mapped_percent_1	STAR_mqc_generalstats_star_uniquely_mapped_1	STAR_mqc_generalstats_star_uniquely_mapped_percent_1	STAR_mqc_generalstats_star_multimapped_1	Cutadapt_mqc_generalstats_cutadapt_percent_trimmed	FastQC_mqc_generalstats_fastqc_percent_duplicates	FastQC_mqc_generalstats_fastqc_percent_gc	FastQC_mqc_generalstats_fastqc_avg_sequence_length	FastQC_mqc_generalstats_fastqc_median_sequence_length	FastQC_mqc_generalstats_fastqc_percent_fails	FastQC_mqc_generalstats_fastqc_total_sequences
SRR5085168	0.115717	18.1481847423948	69.796	0.375334	0.35584699999999997	94.81	0.128805	34.32	0.227042	37.78408578849995	36.3353936353624	46.0	75.0	75	27.27272727272727	0.398717
')

Output collection 'FeatureCounts Summary Table': failed to find identifier 'SRR5085167' in the tool generated elements ['SRR5085168']

Output collection 'Counts Table': failed to find identifier 'SRR5085167' in the tool generated elements ['SRR5085168']

Output collection 'Mapped Reads': failed to find identifier 'SRR5085167' in the tool generated elements ['SRR5085168']

Output collection 'Gene Abundance Estimates from StringTie': failed to find identifier 'SRR5085167' in the tool generated elements ['SRR5085168']

Output collection 'Genes Expression from Cufflinks': failed to find identifier 'SRR5085167' in the tool generated elements ['SRR5085168']

Output collection 'Transcripts Expression from Cufflinks': failed to find identifier 'SRR5085167' in the tool generated elements ['SRR5085168']

Output collection 'Stranded Coverage': failed to find identifier 'SRR5085167_forward' in the tool generated elements ['SRR5085168_forward', 'SRR5085168_reverse']

Output collection 'Unstranded Coverage': failed to find identifier 'SRR5085167' in the tool generated elements ['SRR5085168']

Workflow invocation details

Invocation Messages

Steps

Step 1: Collection paired FASTQ files:
- step_state: scheduled
Step 2: Forward adapter:
- step_state: scheduled

Step 11: Cutadapt (remove adapter + bad quality bases):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -f -s '/tmp/tmpyyie5d_v/files/3/c/d/dataset_3cd2f672-6c5f-4e9c-a1a3-9d13002c4d73.dat' 'SRR5085168.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -a 'Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'='AGATCGGAAGAG'    --error-rate=0.1 --times=1 --overlap=3    --action=trim   --quality-cutoff=30       --minimum-length=15      -o 'out1.fq.gz'  'SRR5085168.fq.gz'  > report.txt

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71a955e11efb356bf5c1a885762"`
adapter_options	`{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"}`
chromInfo	`"/tmp/tmpyyie5d_v/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"discard_casava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "15", "minimum_length2": null, "pair_filter": "any"}`
library	`{"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "AGATCGGAAGAG", "adapter_name": "Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters": [], "front_adapters": []}, "type": "single"}`
other_trimming_options	`{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "30", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}`
output_selector	`["report"]`
read_mod_options	`{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}`

Step 12: get reference_genome as text parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71a955e11efb356bf5c1a885762"`
chromInfo	`"/tmp/tmpyyie5d_v/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "sacCer3", "select_param_type": "text"}}]`
dbkey	`"?"`

Step 13: Get featureCounts strandedness parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71a955e11efb356bf5c1a885762"`
chromInfo	`"/tmp/tmpyyie5d_v/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "1"}, {"__index__": 1, "from": "stranded - reverse", "to": "2"}, {"__index__": 2, "from": "unstranded", "to": "0"}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 14: Get cufflinks strandedness parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71a955e11efb356bf5c1a885762"`
chromInfo	`"/tmp/tmpyyie5d_v/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "fr-secondstrand"}, {"__index__": 1, "from": "stranded - reverse", "to": "fr-firststrand"}, {"__index__": 2, "from": "unstranded", "to": "fr-unstranded"}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 15: Get Stringtie strandedness parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71a955e11efb356bf5c1a885762"`
chromInfo	`"/tmp/tmpyyie5d_v/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "--fr"}, {"__index__": 1, "from": "stranded - reverse", "to": "--rf"}, {"__index__": 2, "from": "unstranded", "to": ""}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 16: STAR: map and count and coverage splitted:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

STAR  --runThreadN ${GALAXY_SLOTS:-4} --genomeLoad NoSharedMemory --genomeDir '/cvmfs/data.galaxyproject.org/managed/rnastar/2.7.4a/sacCer3/sacCer3/dataset_ee6db620-7c48-4da0-8451-017d274c97ca_files' --sjdbOverhang 100 --sjdbGTFfile '/tmp/tmpyyie5d_v/files/9/1/4/dataset_9147c674-7a70-47f7-835c-8ea64342934c.dat' --sjdbGTFfeatureExon 'exon'   --readFilesIn '/tmp/tmpyyie5d_v/files/c/7/7/dataset_c77a15dd-cd7f-4a6d-81ef-4b5a9e7f06f4.dat'   --readFilesCommand zcat   --outSAMtype BAM SortedByCoordinate  --twopassMode None  --quantMode GeneCounts   --outSAMattrIHstart 1 --outSAMattributes NH HI AS nM  --outSAMprimaryFlag OneBestScore  --outSAMmapqUnique 255     --outSAMunmapped None  --outFilterType BySJout --outFilterMultimapScoreRange 1 --outFilterMultimapNmax 20 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.3 --outFilterMismatchNoverReadLmax 0.04 --outFilterScoreMin 0 --outFilterScoreMinOverLread 0.66 --outFilterMatchNmin 0 --outFilterMatchNminOverLread 0.66 --outSAMmultNmax -1 --outSAMtlen 1   --seedSearchStartLmax 50 --seedSearchStartLmaxOverLread 1.0 --seedSearchLmax 0 --seedMultimapNmax 10000 --seedPerReadNmax 1000 --seedPerWindowNmax 50 --seedNoneLociPerWindow 10  --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 --alignSJoverhangMin 8 --alignSJstitchMismatchNmax 0 -1 0 0 --alignSJDBoverhangMin 1 --alignSplicedMateMapLmin 0 --alignSplicedMateMapLminOverLmate 0.66 --alignWindowsPerReadNmax 10000 --alignTranscriptsPerWindowNmax 100 --alignTranscriptsPerReadNmax 10000 --alignEndsType Local --peOverlapNbasesMin 0 --peOverlapMMp 0.01   --limitOutSJoneRead 1000 --limitOutSJcollapsed 1000000 --limitSjdbInsertNsj 1000000  --outBAMsortingThreadN ${GALAXY_SLOTS:-4} --outBAMsortingBinsN 50 --winAnchorMultimapNmax 50 --limitBAMsortRAM $((${GALAXY_MEMORY_MB:-0}*1000000))     --outWigType 'bedGraph' '' --outWigStrand 'Stranded' --outWigReferencesPrefix '-' --outWigNorm 'RPM'  && samtools view -b -o '/tmp/tmpyyie5d_v/job_working_directory/000/8/outputs/dataset_549b07b1-6bf1-44f5-9a3f-5139a3e0e0f8.dat' Aligned.sortedByCoord.out.bam  && mv Signal.Unique.str1.out.bg Signal.Unique.str1.out && mv Signal.UniqueMultiple.str1.out.bg Signal.UniqueMultiple.str1.out && mv Signal.Unique.str2.out.bg Signal.Unique.str2.out && mv Signal.UniqueMultiple.str2.out.bg Signal.UniqueMultiple.str2.out

Exit Code:

```
0
```

Standard Output:

	/usr/local/bin/STAR-avx2 --runThreadN 1 --genomeLoad NoSharedMemory --genomeDir /cvmfs/data.galaxyproject.org/managed/rnastar/2.7.4a/sacCer3/sacCer3/dataset_ee6db620-7c48-4da0-8451-017d274c97ca_files --sjdbOverhang 100 --sjdbGTFfile /tmp/tmpyyie5d_v/files/9/1/4/dataset_9147c674-7a70-47f7-835c-8ea64342934c.dat --sjdbGTFfeatureExon exon --readFilesIn /tmp/tmpyyie5d_v/files/c/7/7/dataset_c77a15dd-cd7f-4a6d-81ef-4b5a9e7f06f4.dat --readFilesCommand zcat --outSAMtype BAM SortedByCoordinate --twopassMode None --quantMode GeneCounts --outSAMattrIHstart 1 --outSAMattributes NH HI AS nM --outSAMprimaryFlag OneBestScore --outSAMmapqUnique 255 --outSAMunmapped None --outFilterType BySJout --outFilterMultimapScoreRange 1 --outFilterMultimapNmax 20 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.3 --outFilterMismatchNoverReadLmax 0.04 --outFilterScoreMin 0 --outFilterScoreMinOverLread 0.66 --outFilterMatchNmin 0 --outFilterMatchNminOverLread 0.66 --outSAMmultNmax -1 --outSAMtlen 1 --seedSearchStartLmax 50 --seedSearchStartLmaxOverLread 1.0 --seedSearchLmax 0 --seedMultimapNmax 10000 --seedPerReadNmax 1000 --seedPerWindowNmax 50 --seedNoneLociPerWindow 10 --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 --alignSJoverhangMin 8 --alignSJstitchMismatchNmax 0 -1 0 0 --alignSJDBoverhangMin 1 --alignSplicedMateMapLmin 0 --alignSplicedMateMapLminOverLmate 0.66 --alignWindowsPerReadNmax 10000 --alignTranscriptsPerWindowNmax 100 --alignTranscriptsPerReadNmax 10000 --alignEndsType Local --peOverlapNbasesMin 0 --peOverlapMMp 0.01 --limitOutSJoneRead 1000 --limitOutSJcollapsed 1000000 --limitSjdbInsertNsj 1000000 --outBAMsortingThreadN 1 --outBAMsortingBinsN 50 --winAnchorMultimapNmax 50 --limitBAMsortRAM 0 --outWigType bedGraph  --outWigStrand Stranded --outWigReferencesPrefix - --outWigNorm RPM
	STAR version: 2.7.11a   compiled: 2023-09-15T02:58:53+0000 :/opt/conda/conda-bld/star_1694746407721/work/source
Oct 28 18:57:27 ..... started STAR run
Oct 28 18:57:27 ..... loading genome
Oct 28 18:58:14 ..... processing annotations GTF
Oct 28 18:58:14 ..... inserting junctions into the genome indices
Oct 28 18:58:21 ..... started mapping
Oct 28 18:58:38 ..... finished mapping
Oct 28 18:58:38 ..... started sorting BAM
Oct 28 18:58:39 ..... started wiggle output
Oct 28 18:58:40 ..... finished successfully

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71a955e11efb356bf5c1a885762"`
algo	{"params": {"__current_case__": 3, "align": {"alignEndsType": "Local", "alignIntronMax": "1000000", "alignIntronMin": "20", "alignMatesGapMax": "1000000", "alignSJDBoverhangMin": "1", "alignSJoverhangMin": "8", "alignSJstitchMismatchNmax": {"alignSJstitchMismatchNmax1": "0", "alignSJstitchMismatchNmax2": "-1", "alignSJstitchMismatchNmax3": "0", "alignSJstitchMismatchNmax4": "0"}, "alignSplicedMateMapLmin": "0", "alignSplicedMateMapLminOverLmate": "0.66", "alignTranscriptsPerReadNmax": "10000", "alignTranscriptsPerWindowNmax": "100", "alignWindowsPerReadNmax": "10000", "peOverlapMMp": "0.01", "peOverlapNbasesMin": "0"}, "chim_settings": {"chimFilter": true, "chimJunctionOverhangMin": "20", "chimMainSegmentMultNmax": "10", "chimMultimapNmax": "1", "chimMultimapScoreRange": "1", "chimScoreDropMax": "20", "chimScoreJunctionNonGTAG": "-1", "chimScoreMin": "0", "chimScoreSeparation": "10", "chimSegmentMin": "12", "chimSegmentReadGapMax": "0"}, "junction_limits": {"limitOutSJcollapsed": "1000000", "limitOutSJoneRead": "1000", "limitSjdbInsertNsj": "1000000"}, "seed": {"seedMultimapNmax": "10000", "seedNoneLociPerWindow": "10", "seedPerReadNmax": "1000", "seedPerWindowNmax": "50", "seedSearchLmax": "0", "seedSearchStartLmax": "50", "seedSearchStartLmaxOverLread": "1.0"}, "settingsType": "full"}}
chimOutType	`""`
chromInfo	`"/tmp/tmpyyie5d_v/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter	`{"basic_filters": ["exclude_unmapped"], "output_params2": {"__current_case__": 0, "outFilterMatchNmin": "0", "outFilterMatchNminOverLread": "0.66", "outFilterMismatchNmax": "999", "outFilterMismatchNoverLmax": "0.3", "outFilterMismatchNoverReadLmax": "0.04", "outFilterMultimapNmax": "20", "outFilterMultimapScoreRange": "1", "outFilterScoreMin": "0", "outFilterScoreMinOverLread": "0.66", "outFilterType": true, "outSAMmultNmax": "-1", "outSAMtlen": "1", "output_select2": "yes"}}`
oformat	`{"HI_offset": "1", "outSAMattributes": ["NH", "HI", "AS", "nM"], "outSAMmapqUnique": "255", "outSAMprimaryFlag": "OneBestScore", "wasp_conditional": {"__current_case__": 1, "waspOutputMode": ""}}`
outWig	`{"__current_case__": 1, "outWigNorm": true, "outWigReferencesPrefix": "-", "outWigStrand": true, "outWigType": "bedGraph", "outWigTypeSecondWord": ""}`
perf	`{"outBAMsortingBinsN": "50", "winAnchorMultimapNmax": "50"}`
refGenomeSource	`{"GTFconditional": {"GTFselect": "without-gtf-with-gtf", "__current_case__": 1, "genomeDir": "sacCer3", "quantmode_output": {"__current_case__": 1, "quantMode": "GeneCounts"}, "sjdbGTFfeatureExon": "exon", "sjdbGTFfile": {"values": [{"id": 1, "src": "hda"}]}, "sjdbOverhang": "100"}, "__current_case__": 0, "geneSource": "indexed"}`
singlePaired	`{"__current_case__": 0, "input1": {"values": [{"id": 2, "src": "dce"}]}, "sPaired": "single"}`
twopass	`{"__current_case__": 0, "sj_precalculated": "", "twopassMode": "None", "twopass_read_subset": ""}`

Step 17: Generate Unstranded Coverage:

step_state: scheduled

Subworkflow Steps

Step 1: STAR log:
- step_state: scheduled
Step 2: STAR BAM:
- step_state: scheduled

Step 3: get scaling factor:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpyyie5d_v/job_working_directory/000/9/configs/tmp0ostmzhi' '/tmp/tmpyyie5d_v/files/0/8/c/dataset_08c6ec87-d16d-4023-a7d7-a9f4f4e4857b.dat' > '/tmp/tmpyyie5d_v/job_working_directory/000/9/outputs/dataset_c7d2669d-b5e3-49b7-8051-fd56f46433d5.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71b955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
code	`"$0~\"Uniquely mapped reads number\"{print 1000000/$NF}"`
dbkey	`"sacCer3"`

Step 4: keep uniquely mapped reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cp '/tmp/tmpyyie5d_v/job_working_directory/000/10/configs/tmp4zys84wt' '/tmp/tmpyyie5d_v/job_working_directory/000/10/outputs/dataset_bdba77cc-fd0e-4766-8193-b867e5879a23.dat' && ln -s '/tmp/tmpyyie5d_v/files/5/4/9/dataset_549b07b1-6bf1-44f5-9a3f-5139a3e0e0f8.dat' localbam.bam && ln -s '/tmp/tmpyyie5d_v/files/_metadata_files/8/2/0/metadata_8202493d-a92a-4202-9d3f-90377fa05d95.dat' localbam.bam.bai && cat '/tmp/tmpyyie5d_v/job_working_directory/000/10/configs/tmp4zys84wt' && bamtools filter -script '/tmp/tmpyyie5d_v/job_working_directory/000/10/configs/tmp4zys84wt' -in localbam.bam -out '/tmp/tmpyyie5d_v/job_working_directory/000/10/outputs/dataset_aa1992ca-c649-43ba-a070-03cb68bd876a.dat'

Exit Code:

```
0
```

Standard Output:

        
{
    "filters": [
        {
            "id": "1",
            "tag": "NH=1"
        }
    ]
}

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"5db6e71b955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
conditions	`[{"__index__": 0, "filters": [{"__index__": 0, "bam_property": {"__current_case__": 21, "bam_property_selector": "tag", "bam_property_value": "NH=1"}}]}]`
dbkey	`"sacCer3"`
rule_configuration	`{"__current_case__": 0, "rules_selector": "false"}`

Step 5: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"5db6e71b955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
param_type	`"float"`
remove_newlines	`true`

Step 6: Scaled Coverage both strands combined:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bedtools genomecov  -ibam '/tmp/tmpyyie5d_v/files/a/a/1/dataset_aa1992ca-c649-43ba-a070-03cb68bd876a.dat'   -split   -bg  -scale 7.76367     > '/tmp/tmpyyie5d_v/job_working_directory/000/31/outputs/dataset_8819c850-cf3a-4c99-88ab-057a4cc3c745.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71b955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
d	`false`
dbkey	`"sacCer3"`
dz	`false`
five	`false`
input_type	`{"__current_case__": 1, "input": {"values": [{"id": 14, "src": "dce"}]}, "input_type_select": "bam"}`
report	`{"__current_case__": 0, "report_select": "bg", "scale": "7.76367", "zero_regions": false}`
split	`true`
strand	`""`
three	`false`

Step 7: convert both strands coverage to bigwig:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -v "^track" '/tmp/tmpyyie5d_v/files/8/8/1/dataset_8819c850-cf3a-4c99-88ab-057a4cc3c745.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len' '/tmp/tmpyyie5d_v/job_working_directory/000/32/outputs/dataset_73a9ef85-76d4-46ac-96ba-d6e113fed20c.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bedgraph"`
__workflow_invocation_uuid__	`"5db6e71b955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
settings	`{"__current_case__": 0, "settingsType": "preset"}`

Step 18: Generate Stranded Coverage:

step_state: scheduled

Subworkflow Steps

Step 1: strandedness:
- step_state: scheduled
Step 2: Bedgraph strand 1:
- step_state: scheduled

Step 11: __MERGE_COLLECTION__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"5db6e71c955e11efb356bf5c1a885762"`
advanced	`{"conflict": {"__current_case__": 3, "duplicate_options": "keep_first"}}`
inputs	`[{"__index__": 0, "input": {"values": [{"id": 29, "src": "hdca"}]}}, {"__index__": 1, "input": {"values": [{"id": 28, "src": "hdca"}]}}]`

Step 12: convert to bigwig:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -v "^track" '/tmp/tmpyyie5d_v/files/5/6/f/dataset_56f58929-c9e3-49db-8d48-29a9dcf7e72a.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len' '/tmp/tmpyyie5d_v/job_working_directory/000/29/outputs/dataset_d868c8b8-ebde-4ff4-b2a8-cda94d8ca875.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bedgraph"`
__workflow_invocation_uuid__	`"5db6e71c955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
settings	`{"__current_case__": 0, "settingsType": "preset"}`

Job 2:

Job state is ok

Command Line:

grep -v "^track" '/tmp/tmpyyie5d_v/files/f/d/e/dataset_fde6503f-4cbc-498e-9197-0ceec2bc446d.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len' '/tmp/tmpyyie5d_v/job_working_directory/000/30/outputs/dataset_099fcdde-f3dd-472e-a97f-9c7f0221a4be.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bedgraph"`
__workflow_invocation_uuid__	`"5db6e71c955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
settings	`{"__current_case__": 0, "settingsType": "preset"}`

Step 3: Bedgraph strand 2:
- step_state: scheduled

Step 4: Get replacement for strand2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71c955e11efb356bf5c1a885762"`
chromInfo	`"/tmp/tmpyyie5d_v/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "$1_reverse"}, {"__index__": 1, "from": "stranded - reverse", "to": "$1_forward"}, {"__index__": 2, "from": "unstranded", "to": "$1_reverse"}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 5: Get replacement for strand1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71c955e11efb356bf5c1a885762"`
chromInfo	`"/tmp/tmpyyie5d_v/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "$1_forward"}, {"__index__": 1, "from": "stranded - reverse", "to": "$1_reverse"}, {"__index__": 2, "from": "unstranded", "to": "$1_forward"}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 6: get identifiers:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mv '/tmp/tmpyyie5d_v/job_working_directory/000/14/configs/tmpou6yhirj' '/tmp/tmpyyie5d_v/job_working_directory/000/14/outputs/dataset_be73d64e-34b2-438a-9a78-8d0f3a01697e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bedgraph"`
__workflow_invocation_uuid__	`"5db6e71c955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
input_collection	`{"values": [{"id": 8, "src": "hdca"}]}`

Step 7: New labels strand 2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpyyie5d_v/job_working_directory/000/15/outputs/dataset_0e2882db-ac7e-48e5-bc7b-8a7d6d53c364.dat' -g    -r '^(.+)$' '$1_reverse' '/tmp/tmpyyie5d_v/files/b/e/7/dataset_be73d64e-34b2-438a-9a78-8d0f3a01697e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71c955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "^(.+)$", "global": true, "is_regex": true, "replace_pattern": "$1_reverse", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 8: New labels strand 1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpyyie5d_v/job_working_directory/000/16/outputs/dataset_6decf4a2-b620-44ee-b4eb-e198ea808aec.dat' -g    -r '^(.+)$' '$1_forward' '/tmp/tmpyyie5d_v/files/b/e/7/dataset_be73d64e-34b2-438a-9a78-8d0f3a01697e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71c955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "^(.+)$", "global": true, "is_regex": true, "replace_pattern": "$1_forward", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 9: Relabelled strand 2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"5db6e71c955e11efb356bf5c1a885762"`
how	`{"__current_case__": 0, "how_select": "txt", "labels": {"values": [{"id": 24, "src": "hda"}]}, "strict": false}`
input	`{"values": [{"id": 10, "src": "hdca"}]}`

Step 10: Relabelled strand 1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"5db6e71c955e11efb356bf5c1a885762"`
how	`{"__current_case__": 0, "how_select": "txt", "labels": {"values": [{"id": 25, "src": "hda"}]}, "strict": false}`
input	`{"values": [{"id": 8, "src": "hdca"}]}`

Step 19: toolshed.g2.bx.psu.edu/repos/iuc/featurecounts/featurecounts/2.0.3+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

export FC_PATH=$(command -v featureCounts | sed 's@/bin/featureCounts$@@') &&  featureCounts  -a '/tmp/tmpyyie5d_v/files/9/1/4/dataset_9147c674-7a70-47f7-835c-8ea64342934c.dat' -F "GTF"  -o "output" -T ${GALAXY_SLOTS:-2}  -s  1  -Q  0     -t 'exon' -g 'gene_id'            --minOverlap  1 --fracOverlap 0 --fracOverlapFeature 0     '/tmp/tmpyyie5d_v/files/5/4/9/dataset_549b07b1-6bf1-44f5-9a3f-5139a3e0e0f8.dat'  && grep -v "^#" "output" | sed -e 's|/tmp/tmpyyie5d_v/files/5/4/9/dataset_549b07b1-6bf1-44f5-9a3f-5139a3e0e0f8.dat|SRR5085168|g' > body.txt && cut -f 1,7 body.txt > '/tmp/tmpyyie5d_v/job_working_directory/000/17/outputs/dataset_456183e1-fd88-436f-92c9-60ea40c3890f.dat'    && sed -e 's|/tmp/tmpyyie5d_v/files/5/4/9/dataset_549b07b1-6bf1-44f5-9a3f-5139a3e0e0f8.dat|SRR5085168|g' 'output.summary' > '/tmp/tmpyyie5d_v/job_working_directory/000/17/outputs/dataset_c3371fcd-d8bd-455f-8957-77c9dd939fee.dat'

Exit Code:

```
0
```

Standard Error:

        ==========     _____ _    _ ____  _____  ______          _____  
        =====         / ____| |  | |  _ \|  __ \|  ____|   /\   |  __ \ 
          =====      | (___ | |  | | |_) | |__) | |__     /  \  | |  | |
            ====      \___ \| |  | |  _ <|  _  /|  __|   / /\ \ | |  | |
              ====    ____) | |__| | |_) | | \ \| |____ / ____ \| |__| |
        ==========   |_____/ \____/|____/|_|  \_\______/_/    \_\_____/
	  v2.0.3

//========================== featureCounts setting ===========================\\
||                                                                            ||
||             Input files : 1 BAM file                                       ||
||                                                                            ||
||                           dataset_549b07b1-6bf1-44f5-9a3f-5139a3e0e0f8 ... ||
||                                                                            ||
||             Output file : output                                           ||
||                 Summary : output.summary                                   ||
||              Paired-end : no                                               ||
||        Count read pairs : no                                               ||
||              Annotation : dataset_9147c674-7a70-47f7-835c-8ea64342934c ... ||
||      Dir for temp files : ./                                               ||
||                                                                            ||
||                 Threads : 1                                                ||
||                   Level : meta-feature level                               ||
||      Multimapping reads : not counted                                      ||
|| Multi-overlapping reads : not counted                                      ||
||   Min overlapping bases : 1                                                ||
||                                                                            ||
\\============================================================================//

//================================= Running ==================================\\
||                                                                            ||
|| Load annotation file dataset_9147c674-7a70-47f7-835c-8ea64342934c.dat ...  ||
||    Features : 7507                                                         ||
||    Meta-features : 7127                                                    ||
||    Chromosomes/contigs : 17                                                ||
||                                                                            ||
|| Process BAM file dataset_549b07b1-6bf1-44f5-9a3f-5139a3e0e0f8.dat...       ||
||    Strand specific : stranded                                              ||
||    Single-end reads are included.                                          ||
||    Total alignments : 637623                                               ||
||    Successfully assigned alignments : 115717 (18.1%)                       ||
||    Running time : 0.01 minutes                                             ||
||                                                                            ||
|| Write the final count table.                                               ||
|| Write the read assignment summary.                                         ||
||                                                                            ||
|| Summary of counting results can be found in file "output.summary"          ||
||                                                                            ||
\\============================================================================//

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71a955e11efb356bf5c1a885762"`
anno	`{"__current_case__": 2, "anno_select": "history", "gff_feature_attribute": "gene_id", "gff_feature_type": "exon", "reference_gene_sets": {"values": [{"id": 1, "src": "hda"}]}, "summarization_level": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
extended_parameters	`{"R": false, "by_read_group": false, "exon_exon_junction_read_counting_enabled": {"__current_case__": 1, "count_exon_exon_junction_reads": ""}, "frac_overlap": "0", "frac_overlap_feature": "0", "largest_overlap": false, "long_reads": false, "min_overlap": "1", "multifeatures": {"__current_case__": 0, "multifeat": ""}, "read_extension_3p": "0", "read_extension_5p": "0", "read_reduction": ""}`
format	`"tabdel_short"`
include_feature_length_file	`false`
pe_parameters	`{"__current_case__": 0, "paired_end_status": "single_end"}`
read_filtering_parameters	`{"ignore_dup": false, "mapping_quality": "0", "primary": false, "splitonly": ""}`
strand_specificity	`"1"`

Step 20: Compute FPKM with StringTie:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mkdir -p ./special_de_output/sample1/ &&   ln -s '/tmp/tmpyyie5d_v/files/9/1/4/dataset_9147c674-7a70-47f7-835c-8ea64342934c.dat' guide.gff &&  stringtie '/tmp/tmpyyie5d_v/files/5/4/9/dataset_549b07b1-6bf1-44f5-9a3f-5139a3e0e0f8.dat'  -o '/tmp/tmpyyie5d_v/job_working_directory/000/18/outputs/dataset_6686df74-87db-49aa-852d-960e53a94844.dat' -p "${GALAXY_SLOTS:-1}"  --fr  -G guide.gff -e -b ./special_de_output/sample1/  -f '0.01' -m '200' -a '10' -j '1' -c '1' -g '50' -M '1.0'   -A '/tmp/tmpyyie5d_v/job_working_directory/000/18/outputs/dataset_aac96e93-caca-4cf7-a69a-ca57d3527a91.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71a955e11efb356bf5c1a885762"`
adv	`{"abundance_estimation": true, "bdist": "50", "bundle_fraction": "1.0", "disable_trimming": false, "fraction": "0.01", "min_anchor_cov": "1", "min_anchor_len": "10", "min_bundle_cov": "1", "min_tlen": "200", "multi_mapping": false, "name_prefix": null, "omit_sequences": "", "point_features": null}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
guide	`{"__current_case__": 1, "coverage_file": false, "guide_source": {"__current_case__": 1, "guide_gff_select": "history", "ref_hist": {"values": [{"id": 1, "src": "hda"}]}}, "input_estimation": true, "special_outputs": {"__current_case__": 2, "special_outputs_select": "no"}, "use_guide": "yes"}`
input_options	`{"__current_case__": 0, "input_bam": {"values": [{"id": 6, "src": "dce"}]}, "input_mode": "short_reads"}`
rna_strandness	`"--fr"`

Step 3: Generate QC reports:
- step_state: scheduled

Step 21: Compute FPKM with cufflinks:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cufflinks -q --no-update-check '/tmp/tmpyyie5d_v/files/5/4/9/dataset_549b07b1-6bf1-44f5-9a3f-5139a3e0e0f8.dat' --num-threads "${GALAXY_SLOTS:-4}" -I 300000 -F 0.1 -j 0.15 --no-effective-length-correction  -G '/tmp/tmpyyie5d_v/files/9/1/4/dataset_9147c674-7a70-47f7-835c-8ea64342934c.dat'   -b '/cvmfs/data.galaxyproject.org/byhand/sacCer3/sam_index/sacCer3.fa'  -u  --library-type fr-secondstrand --frag-len-mean 200 --frag-len-std-dev 80 --max-mle-iterations 5000 --junc-alpha 0.001 --small-anchor-fraction 0.09 --overhang-tolerance 8 --max-bundle-length 10000000 --max-bundle-frags 1000000 --min-intron-length 50 --trim-3-avgcov-thresh 10 --trim-3-dropoff-frac 0.1 2> stderr  && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/d080005cffe1/cufflinks/mass.py' stderr 'None' "transcripts.gtf"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__job_resource	`{"__current_case__": 0, "__job_resource__select": "no"}`
__workflow_invocation_uuid__	`"5db6e71a955e11efb356bf5c1a885762"`
advanced_settings	`{"__current_case__": 1, "inner_dist_std_dev": "80", "inner_mean_dist": "200", "junc_alpha": "0.001", "library_type": "fr-secondstrand", "mask_file": null, "max_bundle_frags": "1000000", "max_bundle_length": "10000000", "max_mle_iterations": "5000", "min_intron_length": "50", "overhang_tolerance": "8", "small_anchor_fraction": "0.09", "trim_three_avgcov_thresh": "10", "trim_three_dropoff_frac": "0.1", "use_advanced_settings": "Yes"}`
bias_correction	`{"__current_case__": 0, "do_bias_correction": "Yes", "seq_source": {"__current_case__": 0, "index": "sacCer3", "index_source": "cached"}}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
global_model	`None`
length_correction	`"--no-effective-length-correction"`
max_intron_len	`"300000"`
min_isoform_fraction	`"0.1"`
multiread_correct	`true`
pre_mrna_fraction	`"0.15"`
reference_annotation	`{"__current_case__": 1, "compatible_hits_norm": "", "reference_annotation_file": {"values": [{"id": 1, "src": "hda"}]}, "use_ref": "Use reference annotation"}`

Step 22: Unlabelled step:

step_state: scheduled

Subworkflow Steps

Step 1: A dummy featureCounts summary file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

times=1; yes -- 'Status__tc__Featurecounts_was_not_used' 2>/dev/null | head -n $times >> '/tmp/tmpyyie5d_v/job_working_directory/000/20/outputs/dataset_f5e9af1a-4434-45df-82cb-cfd5fbc46ad2.dat'; times=1; yes -- 'Assigned__tc__0' 2>/dev/null | head -n $times >> '/tmp/tmpyyie5d_v/job_working_directory/000/20/outputs/dataset_f5e9af1a-4434-45df-82cb-cfd5fbc46ad2.dat'; times=1; yes -- 'Unassigned_Unmapped__tc__0' 2>/dev/null | head -n $times >> '/tmp/tmpyyie5d_v/job_working_directory/000/20/outputs/dataset_f5e9af1a-4434-45df-82cb-cfd5fbc46ad2.dat';

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71d955e11efb356bf5c1a885762"`
chromInfo	`"/tmp/tmpyyie5d_v/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
token_set	`[{"__index__": 0, "line": "Status\tFeaturecounts_was_not_used", "repeat_select": {"__current_case__": 0, "repeat_select_opts": "user", "times": "1"}}, {"__index__": 1, "line": "Assigned\t0", "repeat_select": {"__current_case__": 0, "repeat_select_opts": "user", "times": "1"}}, {"__index__": 2, "line": "Unassigned_Unmapped\t0", "repeat_select": {"__current_case__": 0, "repeat_select_opts": "user", "times": "1"}}]`

Step 2: featureCounts summaries collection:
- step_state: scheduled
Step 3: Strandness param:
- step_state: scheduled
Step 4: RNA STAR count tables:
- step_state: scheduled
Step 5: featureCounts count table:
- step_state: scheduled

Step 6: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

sed --sandbox -r -f '/tmp/tmpyyie5d_v/job_working_directory/000/21/configs/tmp3yyzu976' '/tmp/tmpyyie5d_v/files/f/5/e/dataset_f5e9af1a-4434-45df-82cb-cfd5fbc46ad2.dat' > '/tmp/tmpyyie5d_v/job_working_directory/000/21/outputs/dataset_fb09f98a-faa9-40d4-8ff3-24ccf8ed8fd5.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71d955e11efb356bf5c1a885762"`
adv_opts	`{"__current_case__": 0, "adv_opts_selector": "basic"}`
chromInfo	`"/tmp/tmpyyie5d_v/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"s/__tc__/\\t/g"`
dbkey	`"?"`

Step 7: awk command from strand for STAR counts:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71d955e11efb356bf5c1a885762"`
chromInfo	`"/tmp/tmpyyie5d_v/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "NR>4{print $1\"\\t\"$3}"}, {"__index__": 1, "from": "stranded - reverse", "to": "NR>4{print $1\"\\t\"$4}"}, {"__index__": 2, "from": "unstranded", "to": "NR>4{print $1\"\\t\"$2}"}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 8: featureCounts summaries:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71d955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
style_cond	`{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 17, "src": "dce"}]}}, {"__index__": 1, "value": {"values": [{"id": 36, "src": "hda"}]}}]}}`

Step 9: Extract gene counts:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpyyie5d_v/job_working_directory/000/24/configs/tmpu_r66s9x' '/tmp/tmpyyie5d_v/files/c/5/e/dataset_c5e6b311-2be7-4140-b1dd-cb4cbdea2d87.dat' > '/tmp/tmpyyie5d_v/job_working_directory/000/24/outputs/dataset_3d17ad39-8a82-48f6-b507-1c96d3d34cde.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71d955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
code	`"NR>4{print $1\"\\t\"$3}"`
dbkey	`"sacCer3"`

Step 10: Counts table:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71d955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
style_cond	`{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 16, "src": "dce"}]}}, {"__index__": 1, "value": {"values": [{"id": 26, "src": "dce"}]}}]}}`

Step 23: Combined MultiQC Quality Report:

step_state: scheduled

Subworkflow Steps

Step 1: FASTQ collection:
- step_state: scheduled
Step 2: featureCounts summaries:
- step_state: scheduled

Step 11: Remove duplicates:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

_JAVA_OPTIONS=${_JAVA_OPTIONS:-"-Xmx2048m -Xms256m -Djava.io.tmpdir=${TMPDIR:-${_GALAXY_JOB_TMPDIR}}"} && export _JAVA_OPTIONS &&   ln -sf '/tmp/tmpyyie5d_v/files/5/4/9/dataset_549b07b1-6bf1-44f5-9a3f-5139a3e0e0f8.dat' 'SRR5085168' &&  picard MarkDuplicates  --INPUT 'SRR5085168' --OUTPUT '/tmp/tmpyyie5d_v/job_working_directory/000/37/outputs/dataset_b0e0dbee-3180-463c-8ff5-5ec3d9e8cf7e.dat'  --METRICS_FILE '/tmp/tmpyyie5d_v/job_working_directory/000/37/outputs/dataset_597572a2-6d82-4f14-b4e7-4951547e1917.dat'  --REMOVE_DUPLICATES 'false' --ASSUME_SORTED 'true'  --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES  --OPTICAL_DUPLICATE_PIXEL_DISTANCE '100'   --VALIDATION_STRINGENCY 'LENIENT' --TAGGING_POLICY All --QUIET true --VERBOSITY ERROR

Exit Code:

```
0
```

Standard Error:

/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
Picked up _JAVA_OPTIONS: -Xmx2048m -Xms256m -Djava.io.tmpdir=/tmp/tmpyyie5d_v/tmp
Oct 28, 2024 7:00:45 PM com.intel.gkl.NativeLibraryLoader load
INFO: Loading libgkl_compression.so from jar:file:/usr/local/share/picard-3.1.1-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71e955e11efb356bf5c1a885762"`
assume_sorted	`true`
barcode_tag	`""`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
comments	`[]`
dbkey	`"sacCer3"`
duplicate_scoring_strategy	`"SUM_OF_BASE_QUALITIES"`
optical_duplicate_pixel_distance	`"100"`
read_name_regex	`""`
remove_duplicates	`false`
validation_stringency	`"LENIENT"`

Step 12: Read distribution over genomic features:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s -f '/tmp/tmpyyie5d_v/files/5/4/9/dataset_549b07b1-6bf1-44f5-9a3f-5139a3e0e0f8.dat' 'input.bam' && ln -s -f '/tmp/tmpyyie5d_v/files/_metadata_files/8/2/0/metadata_8202493d-a92a-4202-9d3f-90377fa05d95.dat' 'input.bam.bai' &&  read_distribution.py -i 'input.bam' -r '/tmp/tmpyyie5d_v/files/0/8/b/dataset_08bc987a-c550-4760-b76f-2267dc591987.dat' > '/tmp/tmpyyie5d_v/job_working_directory/000/38/outputs/dataset_2469e92a-9ead-4b50-92f5-b24796a8cfe4.dat'

Exit Code:

```
0
```

Standard Error:

processing /tmp/tmpyyie5d_v/files/0/8/b/dataset_08bc987a-c550-4760-b76f-2267dc591987.dat ... Done
processing input.bam ... Finished

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71e955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`

Step 13: Get gene body coverage:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -sf '/tmp/tmpyyie5d_v/files/6/f/9/dataset_6f94c71b-36d3-4fcd-8755-8f1881d7a449.dat' 'SRR5085168.bam' && ln -sf '/tmp/tmpyyie5d_v/files/_metadata_files/f/d/3/metadata_fd398ed5-d1ad-4d67-ac26-8a80a2de83f5.dat' 'SRR5085168.bam.bai' && geneBody_coverage.py -i 'SRR5085168.bam' -r '/tmp/tmpyyie5d_v/files/0/8/b/dataset_08bc987a-c550-4760-b76f-2267dc591987.dat' --minimum_length 100 -o output

Exit Code:

```
0
```

Standard Error:

@ 2024-10-28 19:01:00: Read BED file (reference gene model) ...
@ 2024-10-28 19:01:01: Total 7127 transcripts loaded
@ 2024-10-28 19:01:01: Get BAM file(s) ...
	SRR5085168.bam
@ 2024-10-28 19:01:01: Processing SRR5085168.bam ...
	100 transcripts finished
 	200 transcripts finished
 	300 transcripts finished
 	400 transcripts finished
 	500 transcripts finished
 	600 transcripts finished
 	700 transcripts finished
 	800 transcripts finished
 	900 transcripts finished
 	1000 transcripts finished
 	1100 transcripts finished
 	1200 transcripts finished
 	1300 transcripts finished
 	1400 transcripts finished
 	1500 transcripts finished
 	1600 transcripts finished
 	1700 transcripts finished
 	1800 transcripts finished
 	1900 transcripts finished
 	2000 transcripts finished
 	2100 transcripts finished
 	2200 transcripts finished
 	2300 transcripts finished
 	2400 transcripts finished
 	2500 transcripts finished
 	2600 transcripts finished
 	2700 transcripts finished
 	2800 transcripts finished
 	2900 transcripts finished
 	3000 transcripts finished
 	3100 transcripts finished
 	3200 transcripts finished
 	3300 transcripts finished
 	3400 transcripts finished
 	3500 transcripts finished
 	3600 transcripts finished
 	3700 transcripts finished
 	3800 transcripts finished
 	3900 transcripts finished
 	4000 transcripts finished
 	4100 transcripts finished
 	4200 transcripts finished
 	4300 transcripts finished
 	4400 transcripts finished
 	4500 transcripts finished
 	4600 transcripts finished
 	4700 transcripts finished
 	4800 transcripts finished
 	4900 transcripts finished
 	5000 transcripts finished
 	5100 transcripts finished
 	5200 transcripts finished
 	5300 transcripts finished
 	5400 transcripts finished
 	5500 transcripts finished
 	5600 transcripts finished
 	5700 transcripts finished
 	5800 transcripts finished
 	5900 transcripts finished
 	6000 transcripts finished
 	6100 transcripts finished
 	6200 transcripts finished
 	6300 transcripts finished
 	6400 transcripts finished
 	6500 transcripts finished
 	6600 transcripts finished
 	6700 transcripts finished
 


	Sample	Skewness
	SRR5085168	4.160063625549754
@ 2024-10-28 19:01:09: Running R script ...

Standard Output:

```
null device 
          1 
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71e955e11efb356bf5c1a885762"`
batch_mode	`{"__current_case__": 0, "batch_mode_selector": "batch", "input": {"values": [{"id": 38, "src": "dce"}]}}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
minimum_length	`"100"`
rscript_output	`false`

Step 14: Combined Quality Report:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/fastqc_0 &&    mkdir 'multiqc_WDir/fastqc_0/data_0' &&  mkdir 'multiqc_WDir/fastqc_0/data_0/file_0' && ln -s '/tmp/tmpyyie5d_v/files/2/6/8/dataset_26808dd9-9452-470f-be18-027b1a136233.dat' 'multiqc_WDir/fastqc_0/data_0/file_0/fastqc_data.txt' &&  mkdir multiqc_WDir/cutadapt_1 &&     ln -s '/tmp/tmpyyie5d_v/files/b/5/f/dataset_b5f72c4c-19aa-4103-908a-e37a2c577323.dat' 'multiqc_WDir/cutadapt_1/SRR5085168.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_1/SRR5085168.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_1/SRR5085168.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&  mkdir multiqc_WDir/star_2 &&    mkdir 'multiqc_WDir/star_2/log_0' &&     ln -s '/tmp/tmpyyie5d_v/files/0/8/c/dataset_08c6ec87-d16d-4023-a7d7-a9f4f4e4857b.dat' 'multiqc_WDir/star_2/log_0/SRR5085168_Log.final.out' &&  mkdir multiqc_WDir/rseqc_3 &&    mkdir 'multiqc_WDir/rseqc_3/read_distribution_0' &&      grep -q 'Group               Total_bases         Tag_count           Tags/Kb' /tmp/tmpyyie5d_v/files/2/4/6/dataset_2469e92a-9ead-4b50-92f5-b24796a8cfe4.dat || die "Module 'rseqc: 'Group               Total_bases         Tag_count           Tags/Kb' not found in the file 'SRR5085168'" && ln -s '/tmp/tmpyyie5d_v/files/2/4/6/dataset_2469e92a-9ead-4b50-92f5-b24796a8cfe4.dat' 'multiqc_WDir/rseqc_3/read_distribution_0/SRR5085168'  &&    mkdir multiqc_WDir/picard_4 &&      mkdir 'multiqc_WDir/picard_4/markdups_0' &&    grep -q 'MarkDuplicates' /tmp/tmpyyie5d_v/files/5/9/7/dataset_597572a2-6d82-4f14-b4e7-4951547e1917.dat || die "Module 'picard: 'MarkDuplicates' not found in the file 'SRR5085168'" && ln -s '/tmp/tmpyyie5d_v/files/5/9/7/dataset_597572a2-6d82-4f14-b4e7-4951547e1917.dat' 'multiqc_WDir/picard_4/markdups_0/SRR5085168'  &&    mkdir multiqc_WDir/rseqc_5 &&    mkdir 'multiqc_WDir/rseqc_5/gene_body_coverage_0' &&  ln -s '/tmp/tmpyyie5d_v/files/5/3/f/dataset_53f4868c-a0e0-473d-93a2-28f66d4b8562.dat' 'multiqc_WDir/rseqc_5/gene_body_coverage_0/file_0.geneBodyCoverage.txt' &&  mkdir multiqc_WDir/samtools_6 &&    mkdir 'multiqc_WDir/samtools_6/idxstats_0' &&     ln -s '/tmp/tmpyyie5d_v/files/6/d/d/dataset_6ddafbb5-e3a1-4b58-ac33-207bdfbbf0c2.dat' 'multiqc_WDir/samtools_6/idxstats_0/SRR5085168_idxstat' &&  mkdir multiqc_WDir/featureCounts_7 &&     if grep -qw Status '/tmp/tmpyyie5d_v/files/c/3/3/dataset_c3371fcd-d8bd-455f-8957-77c9dd939fee.dat'; then ln -s '/tmp/tmpyyie5d_v/files/c/3/3/dataset_c3371fcd-d8bd-455f-8957-77c9dd939fee.dat' 'multiqc_WDir/featureCounts_7/SRR5085168.summary'; else echo -e 'Status\tSRR5085168' > 'multiqc_WDir/featureCounts_7/SRR5085168.summary'; cat '/tmp/tmpyyie5d_v/files/c/3/3/dataset_c3371fcd-d8bd-455f-8957-77c9dd939fee.dat' >> 'multiqc_WDir/featureCounts_7/SRR5085168.summary'; fi &&   multiqc multiqc_WDir --filename 'report'  --title 'Combined Quality Report '      && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

Exit Code:

```
0
```

Standard Error:

/// MultiQC 🎃 v1.24.1

     update_config | Report title: Combined Quality Report 
     version_check | MultiQC Version v1.25.1 now available!
       file_search | Search path: /tmp/tmpyyie5d_v/job_working_directory/000/40/working/multiqc_WDir

             rseqc | Found 1 read_distribution reports
             rseqc | Found 1 gene_body_coverage reports
     featurecounts | Found 1 reports
            picard | Found 1 MarkDuplicates reports
          samtools | Found 1 idxstats reports
              star | Found 1 reports
          cutadapt | Found 1 reports
            fastqc | Found 1 reports

     write_results | Data        : report_data
     write_results | Report      : report.html
           multiqc | MultiQC complete

Standard Output:

total 660
-rw-r--r-- 1 1001 127     79 Oct 28 19:01 cutadapt_filtered_reads_plot.txt
-rw-r--r-- 1 1001 127   1168 Oct 28 19:01 cutadapt_trimmed_sequences_plot_3_Counts.txt
-rw-r--r-- 1 1001 127   1396 Oct 28 19:01 cutadapt_trimmed_sequences_plot_3_Obs_Exp.txt
-rw-r--r-- 1 1001 127    317 Oct 28 19:01 fastqc-status-check-heatmap.txt
-rw-r--r-- 1 1001 127   3444 Oct 28 19:01 fastqc_adapter_content_plot.txt
-rw-r--r-- 1 1001 127    127 Oct 28 19:01 fastqc_overrepresented_sequences_plot.txt
-rw-r--r-- 1 1001 127   1613 Oct 28 19:01 fastqc_per_base_n_content_plot.txt
-rw-r--r-- 1 1001 127   2043 Oct 28 19:01 fastqc_per_base_sequence_quality_plot.txt
-rw-r--r-- 1 1001 127   1680 Oct 28 19:01 fastqc_per_sequence_gc_content_plot_Counts.txt
-rw-r--r-- 1 1001 127   2619 Oct 28 19:01 fastqc_per_sequence_gc_content_plot_Percentages.txt
-rw-r--r-- 1 1001 127    686 Oct 28 19:01 fastqc_per_sequence_quality_scores_plot.txt
-rw-r--r-- 1 1001 127     61 Oct 28 19:01 fastqc_sequence_counts_plot.txt
-rw-r--r-- 1 1001 127    451 Oct 28 19:01 fastqc_sequence_duplication_levels_plot.txt
-rw-r--r-- 1 1001 127   1503 Oct 28 19:01 fastqc_top_overrepresented_sequences_table.txt
-rw-r--r-- 1 1001 127    123 Oct 28 19:01 featureCounts_assignment_plot.txt
-rw-r--r-- 1 1001 127    370 Oct 28 19:01 multiqc_citations.txt
-rw-r--r-- 1 1001 127    216 Oct 28 19:01 multiqc_cutadapt.txt
-rw-r--r-- 1 1001 127 527348 Oct 28 19:01 multiqc_data.json
-rw-r--r-- 1 1001 127    638 Oct 28 19:01 multiqc_fastqc.txt
-rw-r--r-- 1 1001 127    410 Oct 28 19:01 multiqc_featurecounts.txt
-rw-r--r-- 1 1001 127    985 Oct 28 19:01 multiqc_general_stats.txt
-rw-r--r-- 1 1001 127    302 Oct 28 19:01 multiqc_picard_dups.txt
-rw-r--r-- 1 1001 127   1344 Oct 28 19:01 multiqc_rseqc_read_distribution.txt
-rw-r--r-- 1 1001 127    410 Oct 28 19:01 multiqc_samtools_idxstats.txt
-rw-r--r-- 1 1001 127     52 Oct 28 19:01 multiqc_software_versions.txt
-rw-r--r-- 1 1001 127   1150 Oct 28 19:01 multiqc_sources.txt
-rw-r--r-- 1 1001 127    691 Oct 28 19:01 multiqc_star.txt
-rw-r--r-- 1 1001 127     67 Oct 28 19:01 picard_deduplication.txt
-rw-r--r-- 1 1001 127      0 Oct 28 19:01 picard_histogram.txt
-rw-r--r-- 1 1001 127      0 Oct 28 19:01 picard_histogram_1.txt
-rw-r--r-- 1 1001 127      0 Oct 28 19:01 picard_histogram_2.txt
-rw-r--r-- 1 1001 127   1053 Oct 28 19:01 rseqc_gene_body_cov.txt
-rw-r--r-- 1 1001 127   1643 Oct 28 19:01 rseqc_gene_body_coverage_plot_Counts.txt
-rw-r--r-- 1 1001 127   2707 Oct 28 19:01 rseqc_gene_body_coverage_plot_Percentages.txt
-rw-r--r-- 1 1001 127    121 Oct 28 19:01 rseqc_read_distribution_plot.txt
-rw-r--r-- 1 1001 127    574 Oct 28 19:01 samtools-idxstats-mapped-reads-plot_Normalised_Counts.txt
-rw-r--r-- 1 1001 127    561 Oct 28 19:01 samtools-idxstats-mapped-reads-plot_Observed_over_Expected_Counts.txt
-rw-r--r-- 1 1001 127    337 Oct 28 19:01 samtools-idxstats-mapped-reads-plot_Raw_Counts.txt
-rw-r--r-- 1 1001 127    147 Oct 28 19:01 star_alignment_plot.txt
-rw-r--r-- 1 1001 127    365 Oct 28 19:01 star_summary_table.txt

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71e955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
comment	`""`
dbkey	`"sacCer3"`
export	`false`
flat	`false`
results	[{"__index__": 0, "software_cond": {"__current_case__": 8, "output": [{"__index__": 0, "input": {"values": [{"id": 35, "src": "hdca"}]}, "type": "data"}], "software": "fastqc"}}, {"__index__": 1, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}, {"__index__": 2, "software_cond": {"__current_case__": 28, "output": [{"__index__": 0, "type": {"__current_case__": 0, "input": {"values": [{"id": 4, "src": "hdca"}]}, "type": "log"}}], "software": "star"}}, {"__index__": 3, "software_cond": {"__current_case__": 22, "output": [{"__index__": 0, "type": {"__current_case__": 6, "input": {"values": [{"id": 40, "src": "hdca"}]}, "type": "read_distribution"}}], "software": "rseqc"}}, {"__index__": 4, "software_cond": {"__current_case__": 17, "output": [{"__index__": 0, "input": {"values": [{"id": 38, "src": "hdca"}]}, "type": "markdups"}], "software": "picard"}}, {"__index__": 5, "software_cond": {"__current_case__": 22, "output": [{"__index__": 0, "type": {"__current_case__": 1, "input": {"values": [{"id": 42, "src": "hdca"}]}, "type": "gene_body_coverage"}}], "software": "rseqc"}}, {"__index__": 6, "software_cond": {"__current_case__": 24, "output": [{"__index__": 0, "type": {"__current_case__": 2, "input": {"values": [{"id": 37, "src": "hdca"}]}, "type": "idxstats"}}], "software": "samtools"}}, {"__index__": 7, "software_cond": {"__current_case__": 9, "input": {"values": [{"id": 25, "src": "hdca"}]}, "software": "featureCounts"}}]
title	`"Combined Quality Report "`

Step 3: Cutadapt Reports:
- step_state: scheduled
Step 4: STAR logs:
- step_state: scheduled
Step 5: reference_annotation_gtf:
- step_state: scheduled
Step 6: STAR BAM:
- step_state: scheduled

Step 7: FastQC check read qualities:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpyyie5d_v/files/3/c/d/dataset_3cd2f672-6c5f-4e9c-a1a3-9d13002c4d73.dat' 'SRR5085168.gz' && mkdir -p '/tmp/tmpyyie5d_v/job_working_directory/000/33/outputs/dataset_eabd057a-b6e6-48f2-92e2-132d945391fd_files' && fastqc --outdir '/tmp/tmpyyie5d_v/job_working_directory/000/33/outputs/dataset_eabd057a-b6e6-48f2-92e2-132d945391fd_files'   --threads ${GALAXY_SLOTS:-2} --dir ${TEMP:-$_GALAXY_JOB_TMP_DIR} --quiet --extract  --kmers 7 -f 'fastq' 'SRR5085168.gz'  && cp '/tmp/tmpyyie5d_v/job_working_directory/000/33/outputs/dataset_eabd057a-b6e6-48f2-92e2-132d945391fd_files'/*/fastqc_data.txt output.txt && cp '/tmp/tmpyyie5d_v/job_working_directory/000/33/outputs/dataset_eabd057a-b6e6-48f2-92e2-132d945391fd_files'/*\.html output.html

Exit Code:

```
0
```

Standard Output:

```
application/gzip
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71e955e11efb356bf5c1a885762"`
adapters	`None`
chromInfo	`"/tmp/tmpyyie5d_v/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
contaminants	`None`
dbkey	`"?"`
kmers	`"7"`
limits	`None`
min_length	`None`
nogroup	`false`

Step 8: convert gtf to bed12:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gtfToGenePred '/tmp/tmpyyie5d_v/files/9/1/4/dataset_9147c674-7a70-47f7-835c-8ea64342934c.dat' 'temp.genePred' && genePredToBed 'temp.genePred' '/tmp/tmpyyie5d_v/job_working_directory/000/34/outputs/dataset_08bc987a-c550-4760-b76f-2267dc591987.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"gtf"`
__workflow_invocation_uuid__	`"5db6e71e955e11efb356bf5c1a885762"`
advanced_options	`{"__current_case__": 0, "advanced_options_selector": "default"}`
chromInfo	`"/tmp/tmpyyie5d_v/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`

Step 9: Subsample 200k reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   addmemory=${GALAXY_MEMORY_MB_PER_SLOT:-768} && ((addmemory=addmemory*75/100)) &&        ln -s '/tmp/tmpyyie5d_v/files/5/4/9/dataset_549b07b1-6bf1-44f5-9a3f-5139a3e0e0f8.dat' infile && ln -s '/tmp/tmpyyie5d_v/files/_metadata_files/8/2/0/metadata_8202493d-a92a-4202-9d3f-90377fa05d95.dat' infile.bai &&               sample_fragment=`samtools view -c  -f 0 -F 0 -G 0 infile  | awk '{s=$1} END {fac=s/200000; printf("%.8f\n", fac > 1 ? 1/fac : 1)}'` &&  samtools view -@ $addthreads -b  -f 0 -F 0 -G 0 --subsample-seed 1 --subsample ${sample_fragment}   -o outfile      infile

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71e955e11efb356bf5c1a885762"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
mode	{"__current_case__": 1, "filter_config": {"cigarcons": null, "cond_expr": {"__current_case__": 0, "select_expr": "no"}, "cond_region": {"__current_case__": 0, "select_region": "no"}, "cond_rg": {"__current_case__": 0, "select_rg": "no"}, "exclusive_filter": null, "exclusive_filter_all": null, "inclusive_filter": null, "library": "", "qname_file": null, "quality": null, "tag": ""}, "output_options": {"__current_case__": 0, "adv_output": {"collapsecigar": false, "readtags": []}, "complementary_output": false, "output_format": {"__current_case__": 2, "oformat": "bam"}, "reads_report_type": "retained"}, "outtype": "selected_reads", "subsample_config": {"subsampling_mode": {"__current_case__": 1, "seed": "1", "select_subsample": "target", "target": "200000"}}}

Step 10: Get reads number per chromosome:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   ln -s '/tmp/tmpyyie5d_v/files/5/4/9/dataset_549b07b1-6bf1-44f5-9a3f-5139a3e0e0f8.dat' infile && ln -s '/tmp/tmpyyie5d_v/files/_metadata_files/8/2/0/metadata_8202493d-a92a-4202-9d3f-90377fa05d95.dat' infile.bai &&  samtools idxstats -@ $addthreads infile  > '/tmp/tmpyyie5d_v/job_working_directory/000/36/outputs/dataset_6ddafbb5-e3a1-4b58-ac33-207bdfbbf0c2.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"5db6e71e955e11efb356bf5c1a885762"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`

Step 4: Reference genome:
- step_state: scheduled
Step 5: GTF file of annotation:
- step_state: scheduled
Step 6: Strandedness:
- step_state: scheduled
Step 7: Use featureCounts for generating count tables:
- step_state: scheduled
Step 8: Compute Cufflinks FPKM:
- step_state: scheduled
Step 9: GTF with regions to exclude from FPKM normalization with Cufflinks:
- step_state: scheduled
Step 10: Compute StringTie FPKM:
- step_state: scheduled

Other invocation details
- history_id
  - eca5e6c006f5d324
- history_state
  - ok
- invocation_id
  - eca5e6c006f5d324
- invocation_state
  - scheduled
- workflow_id
  - 9d05e37609b9512a

lldelisle · 2024-11-13T16:27:20Z

I made a PR: pavanvidem#2

- improve changelog - use fastp instead of cutadapt - update cufflinks - add multiQC even if no additional QC are performed. - hide intermediate steps - change some parameter names - update README to better description of parameters - add missing asserts in tests

LD edits only

pavanvidem · 2024-11-13T20:04:18Z

better, thanks!

github-actions · 2024-11-13T20:27:59Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

❌ rnaseq-sr.ga_0

Execution Problem:

Final state of invocation 908c299aa36a1a4d is [failed]. Failed to run workflow, at least one job is in [error] state.

Workflow invocation details

Invocation Messages
- Invocation scheduling failed because step 6 requires a dataset created by step 4, but dataset entered a failed state.

Steps

Step 1: Collection of FASTQ files:
- step_state: scheduled
Step 2: Forward adapter:
- step_state: scheduled

Step 11: remove adapters + bad quality bases:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -sf '/tmp/tmpe0fzd0rt/files/b/4/7/dataset_b47a781a-72c1-45e2-8f05-bb68f44a3e76.dat' 'SRR5085167.fastqsanger.gz' &&   cp '/tmp/tmpe0fzd0rt/job_working_directory/000/3/configs/tmpbj59nymu' galaxy.json &&   fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'fastp report for SRR5085167.fastqsanger.gz'   -i 'SRR5085167.fastqsanger.gz'   -o first.fastqsanger.gz     --adapter_sequence 'AGATCGGAAGAG'                  -q 30      -l 15                     && mv first.fastqsanger.gz '/tmp/tmpe0fzd0rt/job_working_directory/000/3/outputs/dataset_98cbb3dc-9d0a-4e32-803f-fd62c5411dec.dat'

Exit Code:

```
0
```

Standard Error:

Read1 before filtering:
total reads: 398717
total bases: 29903775
Q20 bases: 28246987(94.4596%)
Q30 bases: 25590220(85.5752%)

Read1 after filtering:
total reads: 365217
total bases: 18538777
Q20 bases: 17956088(96.8569%)
Q30 bases: 16740644(90.3007%)

Filtering result:
reads passed filter: 365217
reads failed due to low quality: 25120
reads failed due to too many N: 11
reads failed due to too short: 8369
reads with adapter trimmed: 280750
bases trimmed due to adapters: 9911855

Duplication rate (may be overestimated since this is SE data): 28.0603%

JSON report: fastp.json
HTML report: fastp.html

fastp --thread 1 --report_title fastp report for SRR5085167.fastqsanger.gz -i SRR5085167.fastqsanger.gz -o first.fastqsanger.gz --adapter_sequence AGATCGGAAGAG -q 30 -l 15 
fastp v0.23.4, time used: 2 seconds

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"08a1949aa1fd11ef8f6483c394dda809"`
chromInfo	`"/tmp/tmpe0fzd0rt/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": "15"}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": "30", "unqualified_percent_limit": null}}`
output_options	`{"report_html": false, "report_json": true}`
overrepresented_sequence_analysis	`{"overrepresentation_analysis": false, "overrepresentation_sampling": null}`
read_mod_options	`{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_by_quality3": false, "cut_by_quality5": false, "cut_mean_quality": null, "cut_window_size": null}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": null, "umi_prefix": null}}`
single_paired	`{"__current_case__": 0, "adapter_trimming_options": {"adapter_sequence1": "AGATCGGAAGAG", "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_tail1": null}, "in1": {"values": [{"id": 1, "src": "dce"}]}, "single_paired_selector": "single"}`

Step 12: no additional QC:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"08a1949aa1fd11ef8f6483c394dda809"`
chromInfo	`"/tmp/tmpe0fzd0rt/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 3, "input_param": true, "mappings": [{"__index__": 0, "from": false, "to": "true"}, {"__index__": 1, "from": true, "to": "false"}], "type": "boolean"}`
output_param_type	`"boolean"`
unmapped	`{"__current_case__": 0, "on_unmapped": "input"}`

Step 13: get reference_genome as text parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"08a1949aa1fd11ef8f6483c394dda809"`
chromInfo	`"/tmp/tmpe0fzd0rt/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "sacCer3", "select_param_type": "text"}}]`
dbkey	`"?"`

Step 14: Get featureCounts strandedness parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"08a1949aa1fd11ef8f6483c394dda809"`
chromInfo	`"/tmp/tmpe0fzd0rt/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "1"}, {"__index__": 1, "from": "stranded - reverse", "to": "2"}, {"__index__": 2, "from": "unstranded", "to": "0"}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 15: Get cufflinks strandedness parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"08a1949aa1fd11ef8f6483c394dda809"`
chromInfo	`"/tmp/tmpe0fzd0rt/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "fr-secondstrand"}, {"__index__": 1, "from": "stranded - reverse", "to": "fr-firststrand"}, {"__index__": 2, "from": "unstranded", "to": "fr-unstranded"}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 16: Get Stringtie strandedness parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"08a1949aa1fd11ef8f6483c394dda809"`
chromInfo	`"/tmp/tmpe0fzd0rt/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "--fr"}, {"__index__": 1, "from": "stranded - reverse", "to": "--rf"}, {"__index__": 2, "from": "unstranded", "to": ""}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 17: STAR: map and count and coverage splitted:

step_state: scheduled

Jobs

Job 1:

Job state is error

Command Line:

STAR  --runThreadN ${GALAXY_SLOTS:-4} --genomeLoad NoSharedMemory --genomeDir '/cvmfs/data.galaxyproject.org/managed/rnastar/2.7.4a/sacCer3/sacCer3/dataset_ee6db620-7c48-4da0-8451-017d274c97ca_files' --sjdbOverhang 100 --sjdbGTFfile '/tmp/tmpe0fzd0rt/files/0/4/2/dataset_042ce457-50fe-41ec-9be2-2d5efab20783.dat' --sjdbGTFfeatureExon 'exon'   --readFilesIn '/tmp/tmpe0fzd0rt/files/9/8/c/dataset_98cbb3dc-9d0a-4e32-803f-fd62c5411dec.dat'   --outSAMtype BAM SortedByCoordinate  --twopassMode None  --quantMode GeneCounts   --outSAMattrIHstart 1 --outSAMattributes NH HI AS nM  --outSAMprimaryFlag OneBestScore  --outSAMmapqUnique 255     --outSAMunmapped None  --outFilterType BySJout --outFilterMultimapScoreRange 1 --outFilterMultimapNmax 20 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.3 --outFilterMismatchNoverReadLmax 0.04 --outFilterScoreMin 0 --outFilterScoreMinOverLread 0.66 --outFilterMatchNmin 0 --outFilterMatchNminOverLread 0.66 --outSAMmultNmax -1 --outSAMtlen 1   --seedSearchStartLmax 50 --seedSearchStartLmaxOverLread 1.0 --seedSearchLmax 0 --seedMultimapNmax 10000 --seedPerReadNmax 1000 --seedPerWindowNmax 50 --seedNoneLociPerWindow 10  --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 --alignSJoverhangMin 8 --alignSJstitchMismatchNmax 0 -1 0 0 --alignSJDBoverhangMin 1 --alignSplicedMateMapLmin 0 --alignSplicedMateMapLminOverLmate 0.66 --alignWindowsPerReadNmax 10000 --alignTranscriptsPerWindowNmax 100 --alignTranscriptsPerReadNmax 10000 --alignEndsType Local --peOverlapNbasesMin 0 --peOverlapMMp 0.01   --limitOutSJoneRead 1000 --limitOutSJcollapsed 1000000 --limitSjdbInsertNsj 1000000  --outBAMsortingThreadN ${GALAXY_SLOTS:-4} --outBAMsortingBinsN 50 --winAnchorMultimapNmax 50 --limitBAMsortRAM $((${GALAXY_MEMORY_MB:-0}*1000000))     --outWigType 'bedGraph' '' --outWigStrand 'Stranded' --outWigReferencesPrefix '-' --outWigNorm 'RPM'  && samtools view -b -o '/tmp/tmpe0fzd0rt/job_working_directory/000/9/outputs/dataset_7ee05779-59ce-480e-b3f3-27fbda2673f2.dat' Aligned.sortedByCoord.out.bam  && mv Signal.Unique.str1.out.bg Signal.Unique.str1.out && mv Signal.UniqueMultiple.str1.out.bg Signal.UniqueMultiple.str1.out && mv Signal.Unique.str2.out.bg Signal.Unique.str2.out && mv Signal.UniqueMultiple.str2.out.bg Signal.UniqueMultiple.str2.out

Exit Code:

```
104
```

Standard Error:

ReadAlignChunk_processChunks.cpp:204:processChunks EXITING because of FATAL ERROR in input reads: wrong read ID line format: the read ID lines should start with @ or > 
Offending line for read # 1
�����Z�r�ȑ|�o�w��".���"P���*<�;b��_�lPҌ=��0����t��u������_��]�[3����?��ϥi�an����_�F�/����i��|�����S��\���"�HQ~�-R��G(��hQ�Q��R  ��J�)�|�'��˺�KJ)Y�o�����k��
��

������ݻ-mSR����
rYO�i�~���~{o.����BJ����(
SOLUTION: verify and correct the input read files

Nov 13 20:25:01 ...... FATAL ERROR, exiting

Standard Output:

	/usr/local/bin/STAR-avx2 --runThreadN 1 --genomeLoad NoSharedMemory --genomeDir /cvmfs/data.galaxyproject.org/managed/rnastar/2.7.4a/sacCer3/sacCer3/dataset_ee6db620-7c48-4da0-8451-017d274c97ca_files --sjdbOverhang 100 --sjdbGTFfile /tmp/tmpe0fzd0rt/files/0/4/2/dataset_042ce457-50fe-41ec-9be2-2d5efab20783.dat --sjdbGTFfeatureExon exon --readFilesIn /tmp/tmpe0fzd0rt/files/9/8/c/dataset_98cbb3dc-9d0a-4e32-803f-fd62c5411dec.dat --outSAMtype BAM SortedByCoordinate --twopassMode None --quantMode GeneCounts --outSAMattrIHstart 1 --outSAMattributes NH HI AS nM --outSAMprimaryFlag OneBestScore --outSAMmapqUnique 255 --outSAMunmapped None --outFilterType BySJout --outFilterMultimapScoreRange 1 --outFilterMultimapNmax 20 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.3 --outFilterMismatchNoverReadLmax 0.04 --outFilterScoreMin 0 --outFilterScoreMinOverLread 0.66 --outFilterMatchNmin 0 --outFilterMatchNminOverLread 0.66 --outSAMmultNmax -1 --outSAMtlen 1 --seedSearchStartLmax 50 --seedSearchStartLmaxOverLread 1.0 --seedSearchLmax 0 --seedMultimapNmax 10000 --seedPerReadNmax 1000 --seedPerWindowNmax 50 --seedNoneLociPerWindow 10 --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 --alignSJoverhangMin 8 --alignSJstitchMismatchNmax 0 -1 0 0 --alignSJDBoverhangMin 1 --alignSplicedMateMapLmin 0 --alignSplicedMateMapLminOverLmate 0.66 --alignWindowsPerReadNmax 10000 --alignTranscriptsPerWindowNmax 100 --alignTranscriptsPerReadNmax 10000 --alignEndsType Local --peOverlapNbasesMin 0 --peOverlapMMp 0.01 --limitOutSJoneRead 1000 --limitOutSJcollapsed 1000000 --limitSjdbInsertNsj 1000000 --outBAMsortingThreadN 1 --outBAMsortingBinsN 50 --winAnchorMultimapNmax 50 --limitBAMsortRAM 0 --outWigType bedGraph  --outWigStrand Stranded --outWigReferencesPrefix - --outWigNorm RPM
	STAR version: 2.7.11a   compiled: 2023-09-15T02:58:53+0000 :/opt/conda/conda-bld/star_1694746407721/work/source
Nov 13 20:23:54 ..... started STAR run
Nov 13 20:23:55 ..... loading genome
Nov 13 20:24:54 ..... processing annotations GTF
Nov 13 20:24:54 ..... inserting junctions into the genome indices
Nov 13 20:25:01 ..... started mapping

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"08a1949aa1fd11ef8f6483c394dda809"`
algo	{"params": {"__current_case__": 3, "align": {"alignEndsType": "Local", "alignIntronMax": "1000000", "alignIntronMin": "20", "alignMatesGapMax": "1000000", "alignSJDBoverhangMin": "1", "alignSJoverhangMin": "8", "alignSJstitchMismatchNmax": {"alignSJstitchMismatchNmax1": "0", "alignSJstitchMismatchNmax2": "-1", "alignSJstitchMismatchNmax3": "0", "alignSJstitchMismatchNmax4": "0"}, "alignSplicedMateMapLmin": "0", "alignSplicedMateMapLminOverLmate": "0.66", "alignTranscriptsPerReadNmax": "10000", "alignTranscriptsPerWindowNmax": "100", "alignWindowsPerReadNmax": "10000", "peOverlapMMp": "0.01", "peOverlapNbasesMin": "0"}, "chim_settings": {"chimFilter": true, "chimJunctionOverhangMin": "20", "chimMainSegmentMultNmax": "10", "chimMultimapNmax": "1", "chimMultimapScoreRange": "1", "chimScoreDropMax": "20", "chimScoreJunctionNonGTAG": "-1", "chimScoreMin": "0", "chimScoreSeparation": "10", "chimSegmentMin": "12", "chimSegmentReadGapMax": "0"}, "junction_limits": {"limitOutSJcollapsed": "1000000", "limitOutSJoneRead": "1000", "limitSjdbInsertNsj": "1000000"}, "seed": {"seedMultimapNmax": "10000", "seedNoneLociPerWindow": "10", "seedPerReadNmax": "1000", "seedPerWindowNmax": "50", "seedSearchLmax": "0", "seedSearchStartLmax": "50", "seedSearchStartLmaxOverLread": "1.0"}, "settingsType": "full"}}
chimOutType	`""`
chromInfo	`"/tmp/tmpe0fzd0rt/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter	`{"basic_filters": ["exclude_unmapped"], "output_params2": {"__current_case__": 0, "outFilterMatchNmin": "0", "outFilterMatchNminOverLread": "0.66", "outFilterMismatchNmax": "999", "outFilterMismatchNoverLmax": "0.3", "outFilterMismatchNoverReadLmax": "0.04", "outFilterMultimapNmax": "20", "outFilterMultimapScoreRange": "1", "outFilterScoreMin": "0", "outFilterScoreMinOverLread": "0.66", "outFilterType": true, "outSAMmultNmax": "-1", "outSAMtlen": "1", "output_select2": "yes"}}`
oformat	`{"HI_offset": "1", "outSAMattributes": ["NH", "HI", "AS", "nM"], "outSAMmapqUnique": "255", "outSAMprimaryFlag": "OneBestScore", "wasp_conditional": {"__current_case__": 1, "waspOutputMode": ""}}`
outWig	`{"__current_case__": 1, "outWigNorm": true, "outWigReferencesPrefix": "-", "outWigStrand": true, "outWigType": "bedGraph", "outWigTypeSecondWord": ""}`
perf	`{"outBAMsortingBinsN": "50", "winAnchorMultimapNmax": "50"}`
refGenomeSource	`{"GTFconditional": {"GTFselect": "without-gtf-with-gtf", "__current_case__": 1, "genomeDir": "sacCer3", "quantmode_output": {"__current_case__": 1, "quantMode": "GeneCounts"}, "sjdbGTFfeatureExon": "exon", "sjdbGTFfile": {"values": [{"id": 1, "src": "hda"}]}, "sjdbOverhang": "100"}, "__current_case__": 0, "geneSource": "indexed"}`
singlePaired	`{"__current_case__": 0, "input1": {"values": [{"id": 2, "src": "dce"}]}, "sPaired": "single"}`
twopass	`{"__current_case__": 0, "sj_precalculated": "", "twopassMode": "None", "twopass_read_subset": ""}`

Step 18: Generate Unstranded Coverage:

step_state: new

Subworkflow Steps

Step 1: STAR log:
- step_state: scheduled
Step 2: STAR BAM:
- step_state: scheduled

Step 3: get scaling factor:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"08a1949ba1fd11ef8f6483c394dda809"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
code	`"$0~\"Uniquely mapped reads number\"{print 1000000/$NF}"`
dbkey	`"sacCer3"`

Step 4: keep uniquely mapped reads:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"08a1949ba1fd11ef8f6483c394dda809"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
conditions	`[{"__index__": 0, "filters": [{"__index__": 0, "bam_property": {"__current_case__": 21, "bam_property_selector": "tag", "bam_property_value": "NH=1"}}]}]`
dbkey	`"sacCer3"`
rule_configuration	`{"__current_case__": 0, "rules_selector": "false"}`

Step 5: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"08a1949ba1fd11ef8f6483c394dda809"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
param_type	`"float"`
remove_newlines	`true`

Step 6: Scaled Coverage both strands combined:
- step_state: new
Step 7: convert both strands coverage to bigwig:
- step_state: new

Step 19: Generate Stranded Coverage:

step_state: new

Subworkflow Steps

Step 1: strandedness:
- step_state: scheduled
Step 2: Bedgraph strand 1:
- step_state: scheduled
Step 11: Unlabelled step:
- step_state: new
Step 12: convert to bigwig:
- step_state: new
Step 3: Bedgraph strand 2:
- step_state: scheduled

Step 4: Get replacement for strand2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"08a1949ca1fd11ef8f6483c394dda809"`
chromInfo	`"/tmp/tmpe0fzd0rt/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "$1_reverse"}, {"__index__": 1, "from": "stranded - reverse", "to": "$1_forward"}, {"__index__": 2, "from": "unstranded", "to": "$1_reverse"}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 5: Get replacement for strand1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"08a1949ca1fd11ef8f6483c394dda809"`
chromInfo	`"/tmp/tmpe0fzd0rt/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "$1_forward"}, {"__index__": 1, "from": "stranded - reverse", "to": "$1_reverse"}, {"__index__": 2, "from": "unstranded", "to": "$1_forward"}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 6: get identifiers:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bedgraph"`
__workflow_invocation_uuid__	`"08a1949ca1fd11ef8f6483c394dda809"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
input_collection	`{"values": [{"id": 8, "src": "hdca"}]}`

Step 7: New labels strand 2:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"08a1949ca1fd11ef8f6483c394dda809"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "^(.+)$", "global": true, "is_regex": true, "replace_pattern": "$1_reverse", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 8: New labels strand 1:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"08a1949ca1fd11ef8f6483c394dda809"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "^(.+)$", "global": true, "is_regex": true, "replace_pattern": "$1_forward", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 9: Relabelled strand 2:
- step_state: new
Step 10: Relabelled strand 1:
- step_state: new

Step 20: Unlabelled step:
- step_state: new
Step 3: Generate additional QC reports:
- step_state: scheduled
Step 21: Compute FPKM with StringTie:
- step_state: new
Step 22: Compute FPKM with cufflinks:
- step_state: new
Step 23: Unlabelled step:
- step_state: new
- Subworkflow Steps
Step 24: Combined MultiQC without additional QC:
- step_state: new
Step 25: Combined MultiQC Quality Report:
- step_state: new
- Subworkflow Steps
Step 4: Reference genome:
- step_state: scheduled
Step 5: GTF file of annotation:
- step_state: scheduled
Step 6: Strandedness:
- step_state: scheduled
Step 7: Use featureCounts for generating count tables:
- step_state: scheduled
Step 8: Compute Cufflinks FPKM:
- step_state: scheduled
Step 9: GTF with regions to exclude from FPKM normalization with Cufflinks:
- step_state: scheduled
Step 10: Compute StringTie FPKM:
- step_state: scheduled

Other invocation details
- error_message
  - Final state of invocation 908c299aa36a1a4d is [failed]. Failed to run workflow, at least one job is in [error] state.
- history_id
  - 908c299aa36a1a4d
- history_state
  - error
- invocation_id
  - 908c299aa36a1a4d
- invocation_state
  - failed
- messages
  - [{'dependent_workflow_step_id': 3, 'hda_id': 'ac8bc3f92599577f', 'reason': 'dataset_failed', 'workflow_step_id': 5}]
- workflow_id
  - d0ab3900682b7c1f

lldelisle · 2024-11-13T20:35:04Z

@mvdbeek can you help me with this?
It seems that when you use the fastp tool the datatype of the output (the filtered reads) is auto. This prevents me to put the output of fastp into the STAR tool in the workflow editor. To fix this, I changed the datatype of fastp output to fastqsanger hoping that it would work for fastqsanger.gz. It seems that if I run the workflow on usegalaxy.org, galaxy manages to not change the datatype of fastp output and everything works (invocation id 9bbaf0442cd2d8ff) but on the CI, it seems that galaxy changes the datatype from fastqsanger.gz to fastqsanger without ungzipping which leads STAR to fail as the wrapper detected a fastqsanger input so it does not add the --readFilesCommand zcat in the command line...
Thanks

lldelisle

Propose more hidding

workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga

github-actions · 2024-11-13T21:00:43Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

❌ rnaseq-sr.ga_0

Execution Problem:

Final state of invocation 5eff72309df3d108 is [failed]. Failed to run workflow, at least one job is in [error] state.

Workflow invocation details

Invocation Messages
- Invocation scheduling failed because step 6 requires a dataset created by step 4, but dataset entered a failed state.

Steps

Step 1: Collection of FASTQ files:
- step_state: scheduled
Step 2: Forward adapter:
- step_state: scheduled

Step 11: remove adapters + bad quality bases:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -sf '/tmp/tmps2y91k16/files/8/4/5/dataset_84595aaf-adf1-4eb5-93c3-096172ed5d57.dat' 'SRR5085167.fastqsanger.gz' &&   cp '/tmp/tmps2y91k16/job_working_directory/000/3/configs/tmp_l4n8v4y' galaxy.json &&   fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'fastp report for SRR5085167.fastqsanger.gz'   -i 'SRR5085167.fastqsanger.gz'   -o first.fastqsanger.gz     --adapter_sequence 'AGATCGGAAGAG'                  -q 30      -l 15                     && mv first.fastqsanger.gz '/tmp/tmps2y91k16/job_working_directory/000/3/outputs/dataset_dd45d545-69a2-4b06-9819-2108bf6c3175.dat'

Exit Code:

```
0
```

Standard Error:

Read1 before filtering:
total reads: 398717
total bases: 29903775
Q20 bases: 28246987(94.4596%)
Q30 bases: 25590220(85.5752%)

Read1 after filtering:
total reads: 365217
total bases: 18538777
Q20 bases: 17956088(96.8569%)
Q30 bases: 16740644(90.3007%)

Filtering result:
reads passed filter: 365217
reads failed due to low quality: 25120
reads failed due to too many N: 11
reads failed due to too short: 8369
reads with adapter trimmed: 280750
bases trimmed due to adapters: 9911855

Duplication rate (may be overestimated since this is SE data): 28.0603%

JSON report: fastp.json
HTML report: fastp.html

fastp --thread 1 --report_title fastp report for SRR5085167.fastqsanger.gz -i SRR5085167.fastqsanger.gz -o first.fastqsanger.gz --adapter_sequence AGATCGGAAGAG -q 30 -l 15 
fastp v0.23.4, time used: 2 seconds

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"de6a7048a20111ef87a7dfce26e6e41b"`
chromInfo	`"/tmp/tmps2y91k16/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": "15"}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": "30", "unqualified_percent_limit": null}}`
output_options	`{"report_html": false, "report_json": true}`
overrepresented_sequence_analysis	`{"overrepresentation_analysis": false, "overrepresentation_sampling": null}`
read_mod_options	`{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_by_quality3": false, "cut_by_quality5": false, "cut_mean_quality": null, "cut_window_size": null}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": null, "umi_prefix": null}}`
single_paired	`{"__current_case__": 0, "adapter_trimming_options": {"adapter_sequence1": "AGATCGGAAGAG", "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_tail1": null}, "in1": {"values": [{"id": 1, "src": "dce"}]}, "single_paired_selector": "single"}`

Step 12: no additional QC:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"de6a7048a20111ef87a7dfce26e6e41b"`
chromInfo	`"/tmp/tmps2y91k16/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 3, "input_param": true, "mappings": [{"__index__": 0, "from": false, "to": "true"}, {"__index__": 1, "from": true, "to": "false"}], "type": "boolean"}`
output_param_type	`"boolean"`
unmapped	`{"__current_case__": 0, "on_unmapped": "input"}`

Step 13: get reference_genome as text parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"de6a7048a20111ef87a7dfce26e6e41b"`
chromInfo	`"/tmp/tmps2y91k16/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "sacCer3", "select_param_type": "text"}}]`
dbkey	`"?"`

Step 14: Get featureCounts strandedness parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"de6a7048a20111ef87a7dfce26e6e41b"`
chromInfo	`"/tmp/tmps2y91k16/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "1"}, {"__index__": 1, "from": "stranded - reverse", "to": "2"}, {"__index__": 2, "from": "unstranded", "to": "0"}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 15: Get cufflinks strandedness parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"de6a7048a20111ef87a7dfce26e6e41b"`
chromInfo	`"/tmp/tmps2y91k16/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "fr-secondstrand"}, {"__index__": 1, "from": "stranded - reverse", "to": "fr-firststrand"}, {"__index__": 2, "from": "unstranded", "to": "fr-unstranded"}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 16: Get Stringtie strandedness parameter:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"de6a7048a20111ef87a7dfce26e6e41b"`
chromInfo	`"/tmp/tmps2y91k16/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "--fr"}, {"__index__": 1, "from": "stranded - reverse", "to": "--rf"}, {"__index__": 2, "from": "unstranded", "to": ""}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 17: STAR: map and count and coverage splitted:

step_state: scheduled

Jobs

Job 1:

Job state is error

Command Line:

STAR  --runThreadN ${GALAXY_SLOTS:-4} --genomeLoad NoSharedMemory --genomeDir '/cvmfs/data.galaxyproject.org/managed/rnastar/2.7.4a/sacCer3/sacCer3/dataset_ee6db620-7c48-4da0-8451-017d274c97ca_files' --sjdbOverhang 100 --sjdbGTFfile '/tmp/tmps2y91k16/files/b/0/b/dataset_b0b743a7-ee3c-42c8-abff-8a060046503a.dat' --sjdbGTFfeatureExon 'exon'   --readFilesIn '/tmp/tmps2y91k16/files/d/d/4/dataset_dd45d545-69a2-4b06-9819-2108bf6c3175.dat'   --outSAMtype BAM SortedByCoordinate  --twopassMode None  --quantMode GeneCounts   --outSAMattrIHstart 1 --outSAMattributes NH HI AS nM  --outSAMprimaryFlag OneBestScore  --outSAMmapqUnique 255     --outSAMunmapped None  --outFilterType BySJout --outFilterMultimapScoreRange 1 --outFilterMultimapNmax 20 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.3 --outFilterMismatchNoverReadLmax 0.04 --outFilterScoreMin 0 --outFilterScoreMinOverLread 0.66 --outFilterMatchNmin 0 --outFilterMatchNminOverLread 0.66 --outSAMmultNmax -1 --outSAMtlen 1   --seedSearchStartLmax 50 --seedSearchStartLmaxOverLread 1.0 --seedSearchLmax 0 --seedMultimapNmax 10000 --seedPerReadNmax 1000 --seedPerWindowNmax 50 --seedNoneLociPerWindow 10  --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 --alignSJoverhangMin 8 --alignSJstitchMismatchNmax 0 -1 0 0 --alignSJDBoverhangMin 1 --alignSplicedMateMapLmin 0 --alignSplicedMateMapLminOverLmate 0.66 --alignWindowsPerReadNmax 10000 --alignTranscriptsPerWindowNmax 100 --alignTranscriptsPerReadNmax 10000 --alignEndsType Local --peOverlapNbasesMin 0 --peOverlapMMp 0.01   --limitOutSJoneRead 1000 --limitOutSJcollapsed 1000000 --limitSjdbInsertNsj 1000000  --outBAMsortingThreadN ${GALAXY_SLOTS:-4} --outBAMsortingBinsN 50 --winAnchorMultimapNmax 50 --limitBAMsortRAM $((${GALAXY_MEMORY_MB:-0}*1000000))     --outWigType 'bedGraph' '' --outWigStrand 'Stranded' --outWigReferencesPrefix '-' --outWigNorm 'RPM'  && samtools view -b -o '/tmp/tmps2y91k16/job_working_directory/000/9/outputs/dataset_8992ceb8-09c3-4323-9e39-6f78ae338438.dat' Aligned.sortedByCoord.out.bam  && mv Signal.Unique.str1.out.bg Signal.Unique.str1.out && mv Signal.UniqueMultiple.str1.out.bg Signal.UniqueMultiple.str1.out && mv Signal.Unique.str2.out.bg Signal.Unique.str2.out && mv Signal.UniqueMultiple.str2.out.bg Signal.UniqueMultiple.str2.out

Exit Code:

```
104
```

Standard Error:

ReadAlignChunk_processChunks.cpp:204:processChunks EXITING because of FATAL ERROR in input reads: wrong read ID line format: the read ID lines should start with @ or > 
Offending line for read # 1
�����Z�r�ȑ|�o�w��".���"P���*<�;b��_�lPҌ=��0����t��u������_��]�[3����?��ϥi�an����_�F�/����i��|�����S��\���"�HQ~�-R��G(��hQ�Q��R  ��J�)�|�'��˺�KJ)Y�o�����k��
��

������ݻ-mSR����
rYO�i�~���~{o.����BJ����(
SOLUTION: verify and correct the input read files

Nov 13 20:58:38 ...... FATAL ERROR, exiting

Standard Output:

	/usr/local/bin/STAR-avx2 --runThreadN 1 --genomeLoad NoSharedMemory --genomeDir /cvmfs/data.galaxyproject.org/managed/rnastar/2.7.4a/sacCer3/sacCer3/dataset_ee6db620-7c48-4da0-8451-017d274c97ca_files --sjdbOverhang 100 --sjdbGTFfile /tmp/tmps2y91k16/files/b/0/b/dataset_b0b743a7-ee3c-42c8-abff-8a060046503a.dat --sjdbGTFfeatureExon exon --readFilesIn /tmp/tmps2y91k16/files/d/d/4/dataset_dd45d545-69a2-4b06-9819-2108bf6c3175.dat --outSAMtype BAM SortedByCoordinate --twopassMode None --quantMode GeneCounts --outSAMattrIHstart 1 --outSAMattributes NH HI AS nM --outSAMprimaryFlag OneBestScore --outSAMmapqUnique 255 --outSAMunmapped None --outFilterType BySJout --outFilterMultimapScoreRange 1 --outFilterMultimapNmax 20 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.3 --outFilterMismatchNoverReadLmax 0.04 --outFilterScoreMin 0 --outFilterScoreMinOverLread 0.66 --outFilterMatchNmin 0 --outFilterMatchNminOverLread 0.66 --outSAMmultNmax -1 --outSAMtlen 1 --seedSearchStartLmax 50 --seedSearchStartLmaxOverLread 1.0 --seedSearchLmax 0 --seedMultimapNmax 10000 --seedPerReadNmax 1000 --seedPerWindowNmax 50 --seedNoneLociPerWindow 10 --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 --alignSJoverhangMin 8 --alignSJstitchMismatchNmax 0 -1 0 0 --alignSJDBoverhangMin 1 --alignSplicedMateMapLmin 0 --alignSplicedMateMapLminOverLmate 0.66 --alignWindowsPerReadNmax 10000 --alignTranscriptsPerWindowNmax 100 --alignTranscriptsPerReadNmax 10000 --alignEndsType Local --peOverlapNbasesMin 0 --peOverlapMMp 0.01 --limitOutSJoneRead 1000 --limitOutSJcollapsed 1000000 --limitSjdbInsertNsj 1000000 --outBAMsortingThreadN 1 --outBAMsortingBinsN 50 --winAnchorMultimapNmax 50 --limitBAMsortRAM 0 --outWigType bedGraph  --outWigStrand Stranded --outWigReferencesPrefix - --outWigNorm RPM
	STAR version: 2.7.11a   compiled: 2023-09-15T02:58:53+0000 :/opt/conda/conda-bld/star_1694746407721/work/source
Nov 13 20:58:05 ..... started STAR run
Nov 13 20:58:05 ..... loading genome
Nov 13 20:58:31 ..... processing annotations GTF
Nov 13 20:58:31 ..... inserting junctions into the genome indices
Nov 13 20:58:38 ..... started mapping

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"de6a7048a20111ef87a7dfce26e6e41b"`
algo	{"params": {"__current_case__": 3, "align": {"alignEndsType": "Local", "alignIntronMax": "1000000", "alignIntronMin": "20", "alignMatesGapMax": "1000000", "alignSJDBoverhangMin": "1", "alignSJoverhangMin": "8", "alignSJstitchMismatchNmax": {"alignSJstitchMismatchNmax1": "0", "alignSJstitchMismatchNmax2": "-1", "alignSJstitchMismatchNmax3": "0", "alignSJstitchMismatchNmax4": "0"}, "alignSplicedMateMapLmin": "0", "alignSplicedMateMapLminOverLmate": "0.66", "alignTranscriptsPerReadNmax": "10000", "alignTranscriptsPerWindowNmax": "100", "alignWindowsPerReadNmax": "10000", "peOverlapMMp": "0.01", "peOverlapNbasesMin": "0"}, "chim_settings": {"chimFilter": true, "chimJunctionOverhangMin": "20", "chimMainSegmentMultNmax": "10", "chimMultimapNmax": "1", "chimMultimapScoreRange": "1", "chimScoreDropMax": "20", "chimScoreJunctionNonGTAG": "-1", "chimScoreMin": "0", "chimScoreSeparation": "10", "chimSegmentMin": "12", "chimSegmentReadGapMax": "0"}, "junction_limits": {"limitOutSJcollapsed": "1000000", "limitOutSJoneRead": "1000", "limitSjdbInsertNsj": "1000000"}, "seed": {"seedMultimapNmax": "10000", "seedNoneLociPerWindow": "10", "seedPerReadNmax": "1000", "seedPerWindowNmax": "50", "seedSearchLmax": "0", "seedSearchStartLmax": "50", "seedSearchStartLmaxOverLread": "1.0"}, "settingsType": "full"}}
chimOutType	`""`
chromInfo	`"/tmp/tmps2y91k16/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter	`{"basic_filters": ["exclude_unmapped"], "output_params2": {"__current_case__": 0, "outFilterMatchNmin": "0", "outFilterMatchNminOverLread": "0.66", "outFilterMismatchNmax": "999", "outFilterMismatchNoverLmax": "0.3", "outFilterMismatchNoverReadLmax": "0.04", "outFilterMultimapNmax": "20", "outFilterMultimapScoreRange": "1", "outFilterScoreMin": "0", "outFilterScoreMinOverLread": "0.66", "outFilterType": true, "outSAMmultNmax": "-1", "outSAMtlen": "1", "output_select2": "yes"}}`
oformat	`{"HI_offset": "1", "outSAMattributes": ["NH", "HI", "AS", "nM"], "outSAMmapqUnique": "255", "outSAMprimaryFlag": "OneBestScore", "wasp_conditional": {"__current_case__": 1, "waspOutputMode": ""}}`
outWig	`{"__current_case__": 1, "outWigNorm": true, "outWigReferencesPrefix": "-", "outWigStrand": true, "outWigType": "bedGraph", "outWigTypeSecondWord": ""}`
perf	`{"outBAMsortingBinsN": "50", "winAnchorMultimapNmax": "50"}`
refGenomeSource	`{"GTFconditional": {"GTFselect": "without-gtf-with-gtf", "__current_case__": 1, "genomeDir": "sacCer3", "quantmode_output": {"__current_case__": 1, "quantMode": "GeneCounts"}, "sjdbGTFfeatureExon": "exon", "sjdbGTFfile": {"values": [{"id": 1, "src": "hda"}]}, "sjdbOverhang": "100"}, "__current_case__": 0, "geneSource": "indexed"}`
singlePaired	`{"__current_case__": 0, "input1": {"values": [{"id": 2, "src": "dce"}]}, "sPaired": "single"}`
twopass	`{"__current_case__": 0, "sj_precalculated": "", "twopassMode": "None", "twopass_read_subset": ""}`

Step 18: Generate Unstranded Coverage:

step_state: new

Subworkflow Steps

Step 1: STAR log:
- step_state: scheduled
Step 2: STAR BAM:
- step_state: scheduled

Step 3: get scaling factor:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"de6a7049a20111ef87a7dfce26e6e41b"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
code	`"$0~\"Uniquely mapped reads number\"{print 1000000/$NF}"`
dbkey	`"sacCer3"`

Step 4: keep uniquely mapped reads:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"de6a7049a20111ef87a7dfce26e6e41b"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
conditions	`[{"__index__": 0, "filters": [{"__index__": 0, "bam_property": {"__current_case__": 21, "bam_property_selector": "tag", "bam_property_value": "NH=1"}}]}]`
dbkey	`"sacCer3"`
rule_configuration	`{"__current_case__": 0, "rules_selector": "false"}`

Step 5: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"de6a7049a20111ef87a7dfce26e6e41b"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
param_type	`"float"`
remove_newlines	`true`

Step 6: Scaled Coverage both strands combined:
- step_state: new
Step 7: convert both strands coverage to bigwig:
- step_state: new

Step 19: Generate Stranded Coverage:

step_state: new

Subworkflow Steps

Step 1: strandedness:
- step_state: scheduled
Step 2: Bedgraph strand 1:
- step_state: scheduled
Step 11: Unlabelled step:
- step_state: new
Step 12: convert to bigwig:
- step_state: new
Step 3: Bedgraph strand 2:
- step_state: scheduled

Step 4: Get replacement for strand2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"de6a704aa20111ef87a7dfce26e6e41b"`
chromInfo	`"/tmp/tmps2y91k16/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "$1_reverse"}, {"__index__": 1, "from": "stranded - reverse", "to": "$1_forward"}, {"__index__": 2, "from": "unstranded", "to": "$1_reverse"}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 5: Get replacement for strand1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"de6a704aa20111ef87a7dfce26e6e41b"`
chromInfo	`"/tmp/tmps2y91k16/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	`{"__current_case__": 0, "input_param": "stranded - forward", "mappings": [{"__index__": 0, "from": "stranded - forward", "to": "$1_forward"}, {"__index__": 1, "from": "stranded - reverse", "to": "$1_reverse"}, {"__index__": 2, "from": "unstranded", "to": "$1_forward"}], "type": "text"}`
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 6: get identifiers:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bedgraph"`
__workflow_invocation_uuid__	`"de6a704aa20111ef87a7dfce26e6e41b"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
input_collection	`{"values": [{"id": 8, "src": "hdca"}]}`

Step 7: New labels strand 2:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"de6a704aa20111ef87a7dfce26e6e41b"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "^(.+)$", "global": true, "is_regex": true, "replace_pattern": "$1_reverse", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 8: New labels strand 1:

step_state: scheduled

Jobs

Job 1:

Job state is paused

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"de6a704aa20111ef87a7dfce26e6e41b"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/sacCer3.len"`
dbkey	`"sacCer3"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "^(.+)$", "global": true, "is_regex": true, "replace_pattern": "$1_forward", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 9: Relabelled strand 2:
- step_state: new
Step 10: Relabelled strand 1:
- step_state: new

Step 20: Unlabelled step:
- step_state: new
Step 3: Generate additional QC reports:
- step_state: scheduled
Step 21: Compute FPKM with StringTie:
- step_state: new
Step 22: Compute FPKM with cufflinks:
- step_state: new
Step 23: Unlabelled step:
- step_state: new
- Subworkflow Steps
Step 24: Combined MultiQC without additional QC:
- step_state: new
Step 25: Combined MultiQC Quality Report:
- step_state: new
- Subworkflow Steps
Step 4: Reference genome:
- step_state: scheduled
Step 5: GTF file of annotation:
- step_state: scheduled
Step 6: Strandedness:
- step_state: scheduled
Step 7: Use featureCounts for generating count tables:
- step_state: scheduled
Step 8: Compute Cufflinks FPKM:
- step_state: scheduled
Step 9: GTF with regions to exclude from FPKM normalization with Cufflinks:
- step_state: scheduled
Step 10: Compute StringTie FPKM:
- step_state: scheduled

Other invocation details
- error_message
  - Final state of invocation 5eff72309df3d108 is [failed]. Failed to run workflow, at least one job is in [error] state.
- history_id
  - 5eff72309df3d108
- history_state
  - error
- invocation_id
  - 5eff72309df3d108
- invocation_state
  - failed
- messages
  - [{'dependent_workflow_step_id': 3, 'hda_id': '37132e13f4ee8a4a', 'reason': 'dataset_failed', 'workflow_step_id': 5}]
- workflow_id
  - 2c40b984757e5e24

workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga

lldelisle · 2024-11-18T08:06:08Z

@pavanvidem , please see pavanvidem#4

Upgrade fastp

lldelisle

Youhou! Thanks @pavanvidem

pavanvidem added 5 commits October 22, 2024 18:15

Update RNA-seq single-end workflow

7e923ac

update gtf and sample tables links

e4bb5bf

fix tests formatting

727ff8d

add new Yeast test data and remove deseq2 step

1386a92

update changelog and dockstore.yml

4bf47c8

pavanvidem added 2 commits October 29, 2024 10:59

correct the collection element id

0549752

correct the Zenodo record in the CHANGELOG

c4c76ef

nekrut mentioned this pull request Oct 31, 2024

Workflows for "Analysis" page galaxyproject/brc-analytics#144

Open

lldelisle and others added 2 commits November 13, 2024 20:56

- use verion 1.0

a46b479

- improve changelog - use fastp instead of cutadapt - update cufflinks - add multiQC even if no additional QC are performed. - hide intermediate steps - change some parameter names - update README to better description of parameters - add missing asserts in tests

Merge pull request #3 from lldelisle/ld_edits_rnaseq_sr_only

bcf8e99

LD edits only

lldelisle reviewed Nov 13, 2024

View reviewed changes

workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga Outdated Show resolved Hide resolved

workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga Show resolved Hide resolved

workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga Show resolved Hide resolved

Hide more intermediate results

74ffa97

lldelisle reviewed Nov 13, 2024

View reviewed changes

workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga Outdated Show resolved Hide resolved

upgrade fastp

be09ee1

Merge pull request #4 from lldelisle/ld_edits_rnaseq_sr_only

4921cc1

Upgrade fastp

lldelisle approved these changes Nov 19, 2024

View reviewed changes

lldelisle merged commit eb46ef9 into galaxyproject:main Nov 19, 2024
7 checks passed

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Update RNA-seq single-end workflow #580

Update RNA-seq single-end workflow #580

pavanvidem commented Oct 22, 2024

github-actions bot commented Oct 28, 2024

Workflow invocation details

lldelisle commented Nov 13, 2024

pavanvidem commented Nov 13, 2024

github-actions bot commented Nov 13, 2024

Workflow invocation details

lldelisle commented Nov 13, 2024

lldelisle left a comment

github-actions bot commented Nov 13, 2024

Workflow invocation details

lldelisle commented Nov 18, 2024

lldelisle left a comment

Update RNA-seq single-end workflow #580

Update RNA-seq single-end workflow #580

Conversation

pavanvidem commented Oct 22, 2024

github-actions bot commented Oct 28, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

lldelisle commented Nov 13, 2024

pavanvidem commented Nov 13, 2024

github-actions bot commented Nov 13, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

lldelisle commented Nov 13, 2024

lldelisle left a comment

Choose a reason for hiding this comment

github-actions bot commented Nov 13, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

lldelisle commented Nov 18, 2024

lldelisle left a comment

Choose a reason for hiding this comment