Merge pull request #580 from pavanvidem/rnaseq-sr-0.10

Update RNA-seq single-end workflow

workflows/transcriptomics/rnaseq-sr/.dockstore.yml

@@ -9,3 +9,5 @@ workflows:
   authors:
   - name: Lucille Delisle
     orcid: 0000-0002-1964-4960
+  - name: Pavankumar Videm
+    orcid: 0000-0002-5192-126X

workflows/transcriptomics/rnaseq-sr/CHANGELOG.md

@@ -1,5 +1,18 @@
 # Changelog
 
+## [1.0] 2024-10-22
+
+### Changes in workflows
+- Add an optional subworkflow with more QC: FastQC, Picard, Read distribution on genomic features, gene body coverage, reads per chromosomes.
+- Add featureCounts as an alternative way to generate count files
+- Use fastp instead of cutadapt which uses pair overlap and allows to have optional adapter sequences
+
+### Tool update
+- `toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.3` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.4`
+
+### Test dataset
+- Using a new subsampled Yeast test data from Zenodo record https://zenodo.org/records/13987631
+
 ## [0.9] 2024-09-23
 
 ### Automatic update

workflows/transcriptomics/rnaseq-sr/README.md

@@ -2,9 +2,9 @@
 
 ## Inputs dataset
 
-- The workflow needs a list of datasets of fastqsanger.
-- As well as a gtf file with genes
-- Optional, but recommended: a gtf file with regions to exclude from normalization in Cufflinks.
+- Collection of FASTQ files: The workflow needs a list of datasets of fastqsanger.
+- GTF file of annotation: A gtf file with genes annotation.
+- GTF with regions to exclude from FPKM normalization with Cufflinks: Optional, but recommended. A gtf file with regions to exclude from normalization in Cufflinks.
 
   - For instance a gtf that masks chrM for the mm10 genome:
 
@@ -15,11 +15,13 @@ chrM	chrM_gene	exon	0	16299	.	-	.	gene_id "chrM_gene_minus"; transcript_id "chrM
 
 ## Inputs values
 
-- forward adapter sequence: this depends on the library preparation. Usually classical Illumina RNA libraries are Truseq and ISML (relatively new Illumina library) is Nextera. If you don't know, use FastQC to determine if it is Truseq or Nextera. If the read length is relatively short (50bp), there is probably no adapter so it will not impact your results.
-- reference_genome: this field will be adapted to the genomes available for STAR
-- strandedness: For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence. This will only count alignments that are compatible with your library preparation strategy. This is also used for the stranded coverage and for FPKM computation with cufflinks/StringTie.
-- cufflinks_FPKM: Whether you want to get FPKM with Cufflinks (pretty long)
-- stringtie_FPKM: Whether you want to get FPKM/TPM etc... with Stringtie.
+- Forward adapter (optional): If not provided, fastp will try to guess the adapter sequence from the data. Its sequences  depends on the library preparation. Usually classical Illumina RNA libraries are Truseq and ISML (relatively new Illumina library) is Nextera. If you don't know, use FastQC to determine if it is Truseq or Nextera. If the read length is relatively short (50bp), there is probably no adapter so it will not impact your results.
+- Generate additional QC reports: whether to compute additional QC: FastQC, Picard, Read distribution on genomic features, gene body coverage, reads per chromosomes.
+- Reference genome: this field will be adapted to the genomes available for STAR.
+- Strandedness: For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence. This will only count alignments that are compatible with your library preparation strategy. This is also used for the stranded coverage and for FPKM computation with cufflinks/StringTie.
+- Use featureCounts for generating count tables: Whether to use count tables from featureCounts instead of from STAR.
+- Compute Cufflinks FPKM: Whether you want to get FPKM with Cufflinks (pretty long).
+- Compute StringTie FPKM: Whether you want to get FPKM/TPM etc... with StringTie.
 
 ## Processing
 
@@ -41,6 +43,12 @@ chrM	chrM_gene	exon	0	16299	.	-	.	gene_id "chrM_gene_minus"; transcript_id "chrM
 
 ## Contribution
 
+### Version 0.1
+
 @lldelisle wrote the workflow and the tests.
 
 @nagoue updated the tools, made it work in usegalaxy.org, fixed some best practices.
+
+### Version 1.0
+
+@pavanvidem added the new features (featurecount + additional QC) and found a smaller test dataset.

workflows/transcriptomics/rnaseq-sr/rnaseq-sr-tests.yml

@@ -1,101 +1,76 @@
 - doc: Test outline for RNAseq_SR
   job:
-    gtf:
+    GTF file of annotation:
       class: File
-      location: https://zenodo.org/record/4541751/files/Drosophila_melanogaster.BDGP6.87.gtf
+      location: https://zenodo.org/records/13987631/files/Saccharomyces_cerevisiae.R64-1-1.113.gtf
       filetype: gtf
-    SR fastq input:
+    Collection of FASTQ files:
       class: Collection
       collection_type: list
       elements:
       - class: File
-        identifier: GSM461177
-        location: https://zenodo.org/record/4541751/files/GSM461177_1_subsampled.fastqsanger
-    forward_adapter: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
-    reference_genome: dm6
-    strandedness: unstranded
-    cufflinks_FPKM: true
-    stringtie_FPKM: true
+        identifier: SRR5085167
+        location: https://zenodo.org/records/13987631/files/SRR5085167_forward.fastqsanger.gz
+    Forward adapter: AGATCGGAAGAG
+    Generate additional QC reports: true
+    Reference genome: sacCer3
+    Strandedness: stranded - forward
+    Use featureCounts for generating count tables: true
+    Compute Cufflinks FPKM: true
+    GTF with regions to exclude from FPKM normalization with Cufflinks: null
+    Compute StringTie FPKM: true
   outputs:
-    output_log:
-      element_tests:
-        GSM461177:
-          asserts:
-            - that: "has_text"
-              text: "Number of input reads |\t1051466"
-            - that: "has_text"
-              text: "Uniquely mapped reads number |\t871202"
-            - that: "has_text"
-              text: "Number of reads mapped to multiple loci |\t91808"
-    mapped-reads:
-      element_tests:
-        GSM461177:
-          asserts:
-            has_size:
-              value: 43037033
-              delta: 4000000
-  'MultiQC on input dataset(s): Stats':
-    asserts:
-      has_line:
-        line: "Sample	STAR_mqc_generalstats_star_total_reads_1	STAR_mqc_generalstats_star_mapped_1	STAR_mqc_generalstats_star_mapped_percent_1	STAR_mqc_generalstats_star_uniquely_mapped_1	STAR_mqc_generalstats_star_uniquely_mapped_percent_1	STAR_mqc_generalstats_star_multimapped_1	Cutadapt_mqc_generalstats_cutadapt_percent_trimmed"
-      has_text_matching:
-        expression: "GSM461177\t1.0[0-9]*\t0.96[0-9]*\t91.[0-9]*\t0.8[0-9]*\t82.8[0-9]*\t0.091[0-9]*\t4.0[0-9]*"
-    MultiQC webpage:
+    MultiQC stats:
       asserts:
-        - that: "has_text"
-          text: "GSM461177"
-        - that: "has_text"
-          text: "<a href=\"#cutadapt_filtered_reads\" class=\"nav-l2\">Filtered Reads</a>"
-        - that: "has_text"
-          text: "<a href=\"#star\" class=\"nav-l1\">STAR</a>"
-    reads_per_gene from STAR:
+        has_text_matching:
+          expression: "SRR5085167\t0.11[0-9]*\t18.3[0-9]*\t69.6[0-9]*\t0.3[0-9]*\t0.3[0-9]*\t94.62\t0.12[0-9]*\t34.43\t0.2[0-9]*\t28.[0-9]*\t90.[0-9]*\t16.[0-9]*\t0.36[0-9]*\t43.[0-9]*\t91.[0-9]*\t70.[0-9]*\t36.[0-9]*\t46.0\t75.0\t75\t27.27[0-9]*\t0.39[0-9]*"
+    Counts Table:
       element_tests:
-        GSM461177:
+        SRR5085167:
           asserts:
-            - that: "has_text"
-              text: "N_ambiguous\t20961\t5272\t4705"
-            - that: "has_text"
-              text: "FBgn0010247\t14\t6\t8"
-    HTS count like output:
+            has_line:
+              line: "YAL038W	1775"
+    Mapped Reads:
       element_tests:
-        GSM461177:
+        SRR5085167:
           asserts:
-            has_text:
-              text: "FBgn0010247\t14"
-    transcripts_expression_cufflinks:
+            has_size:
+              value: 31570787
+              delta: 3000000
+    Gene Abundance Estimates from StringTie:
       element_tests:
-        GSM461177:
+        SRR5085167:
           asserts:
-            has_text:
-              text: "FBtr0078104\t-\t-\tFBgn0031217\tCG11377\t-\tchr2L:102379-104142\t1583\t0.626702\t18.291\t9.78605\t26.796\tOK"
-    genes_expression_cufflinks:
+            has_text_matching:
+              expression: "YAL038W\tCDC19\tchrI\t\\+\t71786\t73288\t57.[0-9]*\t3575.[0-9]*\t3084.[0-9]*"
+    Genes Expression from Cufflinks:
       element_tests:
-        GSM461177:
+        SRR5085167:
           asserts:
-            has_text_matching:
-              expression: "FBgn0031217\t-\t-\tFBgn0031217\tCG11377\t-\tchr2L:102379-104142\t-\t-\t32.1016\t22.1771\t42.02[0-9]*\tOK"
-    genes_expression_stringtie:
+            has_line:
+              line: "YAL038W	-	-	YAL038W	CDC19	-	chrI:71785-73288	-	-	3375.85	3161.36	3590.33	OK"
+    Transcripts Expression from Cufflinks:
       element_tests:
-        GSM461177:
+        SRR5085167:
           asserts:
-            has_text:
-              text: "FBgn0031220\tCG4822\tchr2L\t-\t116970\t121754\t1.067492\t36.649773\t74.784904"
-    both strands coverage:
+            has_line:
+              line: "YAL038W_mRNA	-	-	YAL038W	CDC19	-	chrI:71785-73288	1503	57.5601	3375.85	3161.36	3590.33	OK"
+    Stranded Coverage:
       element_tests:
-        GSM461177:
+        SRR5085167_forward:
           asserts:
             has_size:
-              value: 6075761
-              delta: 600000
-    stranded coverage:
-      element_tests:
-        GSM461177_reverse:
+              value: 555489
+              delta: 50000
+        SRR5085167_reverse:
           asserts:
             has_size:
-              value: 3103918
-              delta: 300000
-        GSM461177_forward:
+              value: 526952
+              delta: 50000
+    Unstranded Coverage:
+      element_tests:
+        SRR5085167:
           asserts:
             has_size:
-              value: 3103918
-              delta: 300000
+              value: 978542
+              delta: 90000