unicycler: make gfa output really gfa (#3213)

* unicycler: make gfa output really gfa

* generalize gfa output assertions

seems that the sequence in the gfa is reverse complememted (and maybe
also shifted). which is because its circular. so the old assertion did
not work.

* test unicycler

.tt_skip

@@ -7,5 +7,4 @@ tools/migmap/
 tools/ncbi_entrez_eutils/einfo.xml
 tools/sarscov2formatter/sarscov2formatter.xml
 tools/trinotate
-tools/unicycler
 tools/valet

tools/unicycler/unicycler.xml

@@ -1,4 +1,4 @@
-<tool id="unicycler" name="Create assemblies with Unicycler" version="@[email protected]">
+<tool id="unicycler" name="Create assemblies with Unicycler" version="@[email protected]" profile="20.09">
     <macros>
         <token name="@VERSION@">0.4.8</token>
     </macros>
@@ -204,7 +204,7 @@ $pilon.no_pilon
         </section>
     </inputs>
     <outputs>
-        <data name="assembly_graph" format="tabular" from_work_dir="assembly.gfa" label="${tool.name} on ${on_string}: Final Assembly Graph" />
+        <data name="assembly_graph" format="gfa1" from_work_dir="assembly.gfa" label="${tool.name} on ${on_string}: Final Assembly Graph" />
         <data name="assembly" format="fasta" from_work_dir="assembly.fasta" label="${tool.name} on ${on_string}: Final Assembly"/>
     </outputs>
     <tests>
@@ -240,9 +240,9 @@ $pilon.no_pilon
             <section name="lr_align">
                 <param name="scores" value="3,-6,-5,-2"/>
             </section>
-            <output name="assembly_graph" ftype="tabular">
+            <output name="assembly_graph" ftype="gfa1">
                 <assert_contents>
-                    <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC"/>
+                    <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/>
                 </assert_contents>
             </output>
             <output name="assembly" ftype="fasta">
@@ -295,9 +295,9 @@ $pilon.no_pilon
             <section name="lr_align">
                 <param name="scores" value="3,-6,-5,-2"/>
             </section>
-            <output name="assembly_graph" ftype="tabular">
+            <output name="assembly_graph" ftype="gfa1">
                 <assert_contents>
-                    <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" />
+                    <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/>
                 </assert_contents>
             </output>
             <output name="assembly" ftype="fasta">
@@ -342,9 +342,9 @@ $pilon.no_pilon
             <section name="lr_align">
                 <param name="scores" value="3,-6,-5,-2"/>
             </section>
-            <output name="assembly_graph" ftype="tabular">
+            <output name="assembly_graph" ftype="gfa1">
                 <assert_contents>
-                    <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" />
+                    <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/>
                 </assert_contents>
             </output>
             <output name="assembly" ftype="fasta">
@@ -362,7 +362,7 @@ $pilon.no_pilon
                 <param name="kmers" value="21,23"/>
             </section>
             <param name="long" value="only_long.fasta" ftype="fasta" />
-            <output name="assembly_graph" ftype="tabular">
+            <output name="assembly_graph" ftype="gfa1">
                 <assert_contents>
                     <has_text text="S" />
                 </assert_contents>