generalize gfa output assertions

seems that the sequence in the gfa is reverse complememted (and maybe also shifted). which is because its circular. so the old assertion did not work.
galaxyproject · Nov 5, 2020 · c2b6575 · c2b6575
1 parent 5a6067c
commit c2b6575
Showing 1 changed file with 3 additions and 3 deletions.
diff --git a/tools/unicycler/unicycler.xml b/tools/unicycler/unicycler.xml
@@ -242,7 +242,7 @@ $pilon.no_pilon
             </section>
             <output name="assembly_graph" ftype="gfa1">
                 <assert_contents>
-                    <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC"/>
+                    <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/>
                 </assert_contents>
             </output>
             <output name="assembly" ftype="fasta">
@@ -297,7 +297,7 @@ $pilon.no_pilon
             </section>
             <output name="assembly_graph" ftype="gfa1">
                 <assert_contents>
-                    <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" />
+                    <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/>
                 </assert_contents>
             </output>
             <output name="assembly" ftype="fasta">
@@ -344,7 +344,7 @@ $pilon.no_pilon
             </section>
             <output name="assembly_graph" ftype="gfa1">
                 <assert_contents>
-                    <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" />
+                    <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/>
                 </assert_contents>
             </output>
             <output name="assembly" ftype="fasta">