-
Notifications
You must be signed in to change notification settings - Fork 441
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
unicycler: make gfa output really gfa
1 parent
fa78db0
commit 5a6067c
Showing
1 changed file
with
6 additions
and
6 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,4 +1,4 @@ | ||
<tool id="unicycler" name="Create assemblies with Unicycler" version="@[email protected]"> | ||
<tool id="unicycler" name="Create assemblies with Unicycler" version="@[email protected]" profile="20.09"> | ||
<macros> | ||
<token name="@VERSION@">0.4.8</token> | ||
</macros> | ||
|
@@ -204,7 +204,7 @@ $pilon.no_pilon | |
</section> | ||
</inputs> | ||
<outputs> | ||
<data name="assembly_graph" format="tabular" from_work_dir="assembly.gfa" label="${tool.name} on ${on_string}: Final Assembly Graph" /> | ||
<data name="assembly_graph" format="gfa1" from_work_dir="assembly.gfa" label="${tool.name} on ${on_string}: Final Assembly Graph" /> | ||
<data name="assembly" format="fasta" from_work_dir="assembly.fasta" label="${tool.name} on ${on_string}: Final Assembly"/> | ||
</outputs> | ||
<tests> | ||
|
@@ -240,7 +240,7 @@ $pilon.no_pilon | |
<section name="lr_align"> | ||
<param name="scores" value="3,-6,-5,-2"/> | ||
</section> | ||
<output name="assembly_graph" ftype="tabular"> | ||
<output name="assembly_graph" ftype="gfa1"> | ||
<assert_contents> | ||
<has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC"/> | ||
</assert_contents> | ||
|
@@ -295,7 +295,7 @@ $pilon.no_pilon | |
<section name="lr_align"> | ||
<param name="scores" value="3,-6,-5,-2"/> | ||
</section> | ||
<output name="assembly_graph" ftype="tabular"> | ||
<output name="assembly_graph" ftype="gfa1"> | ||
<assert_contents> | ||
<has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" /> | ||
</assert_contents> | ||
|
@@ -342,7 +342,7 @@ $pilon.no_pilon | |
<section name="lr_align"> | ||
<param name="scores" value="3,-6,-5,-2"/> | ||
</section> | ||
<output name="assembly_graph" ftype="tabular"> | ||
<output name="assembly_graph" ftype="gfa1"> | ||
<assert_contents> | ||
<has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" /> | ||
</assert_contents> | ||
|
@@ -362,7 +362,7 @@ $pilon.no_pilon | |
<param name="kmers" value="21,23"/> | ||
</section> | ||
<param name="long" value="only_long.fasta" ftype="fasta" /> | ||
<output name="assembly_graph" ftype="tabular"> | ||
<output name="assembly_graph" ftype="gfa1"> | ||
<assert_contents> | ||
<has_text text="S" /> | ||
</assert_contents> | ||
|