4.1.5 + start updating tests

galaxyproject · Apr 19, 2023 · 0e597ee · 0e597ee
1 parent 1a3994a
commit 0e597ee
Show file tree

Hide file tree

Showing 7 changed files with 19 additions and 17 deletions.
diff --git a/tools/repeatmasker/macros.xml b/tools/repeatmasker/macros.xml
@@ -1,5 +1,5 @@
 <macros>
-    <token name="@TOOL_VERSION@">4.1.2-p3</token>
+    <token name="@TOOL_VERSION@">4.1.5</token>
     <token name="@VERSION_SUFFIX@">galaxy0</token>
     <xml name="edam_ontology">
         <edam_topics>

diff --git a/tools/repeatmasker/test-data/small_dfam.fasta.cat b/tools/repeatmasker/test-data/small_dfam.fasta.cat
@@ -82,6 +82,7 @@ C AmnL2-1#LINE/       2556 ACGCTTTACAGAGTTAAATAAT 2535
 
 Matrix = 25p39g.matrix
 Kimura (with divCpGMod) = 29.45
+CpG sites = 10, Kimura (unadjusted) = 31.65
 Transitions / transversions = 1.43 (10/7)
 Gap_init rate = 0.07 (5 / 70), avg. gap size = 1.00 (5 / 5)
 
@@ -113,6 +114,6 @@ Gap_init rate = 0.03 (1 / 35), avg. gap size = 1.00 (1 / 1)
 ## Total Length: 14220
 ## Total NonMask ( excluding >20bp runs of N/X bases ): 14220
 ## Total NonSub ( excluding all non ACGT bases ):14220
-RepeatMasker version 4.1.2-p1 , default mode
-run with rmblastn version 2.10.0+
-RM Library: CONS-Dfam_3.3
+RepeatMasker version 4.1.5 , default mode
+run with rmblastn version 2.13.0+
+RM Library: CONS-Dfam_3.7
diff --git a/tools/repeatmasker/test-data/small_dfam.fasta.log b/tools/repeatmasker/test-data/small_dfam.fasta.log
@@ -1,4 +1,4 @@
-SW scoret% div.t% del.t% ins.tquery sequencetpos in  query: begintendt(left)trepeattclass/familytpos in repeat: begintendt(left)tID
+SW score	% div.	% del.	% ins.	query sequence	pos in  query: begin	end	(left)	repeat	class/family	pos in repeat: begin	end	(left)	ID
 
 18	0.0	0.0	0.0	scaffold_1	613	632	(13588)	(GT)n	Simple_repeat	1	20	(0)	1
 16	18.3	2.2	2.2	scaffold_1	780	824	(13396)	(ATAATA)n	Simple_repeat	1	45	(0)	2

diff --git a/tools/repeatmasker/test-data/small_dfam.fasta.stats b/tools/repeatmasker/test-data/small_dfam.fasta.stats
@@ -45,7 +45,7 @@ Low complexity:       0            0 bp    0.00 %
 
 
 The query species was assumed to be human         
-RepeatMasker version 4.1.2-p1 , default mode
-
-run with rmblastn version 2.10.0+
-FamDB: CONS-Dfam_3.3
+RepeatMasker version 4.1.5 , default mode
+                                        
+run with rmblastn version 2.13.0+
+FamDB: CONS-Dfam_3.7
diff --git a/tools/repeatmasker/test-data/small_dfam_rattus.fasta.cat b/tools/repeatmasker/test-data/small_dfam_rattus.fasta.cat
@@ -98,6 +98,6 @@ Gap_init rate = 0.03 (1 / 35), avg. gap size = 1.00 (1 / 1)
 ## Total Length: 14220
 ## Total NonMask ( excluding >20bp runs of N/X bases ): 14220
 ## Total NonSub ( excluding all non ACGT bases ):14220
-RepeatMasker version 4.1.2-p1 , default mode
-run with rmblastn version 2.10.0+
-RM Library: CONS-Dfam_3.3
+RepeatMasker version 4.1.5 , default mode
+run with rmblastn version 2.13.0+
+RM Library: CONS-Dfam_3.7
diff --git a/tools/repeatmasker/test-data/small_dfam_rattus.fasta.log b/tools/repeatmasker/test-data/small_dfam_rattus.fasta.log
@@ -1,4 +1,4 @@
-SW scoret% div.t% del.t% ins.tquery sequencetpos in  query: begintendt(left)trepeattclass/familytpos in repeat: begintendt(left)tID
+SW score	% div.	% del.	% ins.	query sequence	pos in  query: begin	end	(left)	repeat	class/family	pos in repeat: begin	end	(left)	ID
 
 18	0.0	0.0	0.0	scaffold_1	613	632	(13588)	(GT)n	Simple_repeat	1	20	(0)	1
 16	18.3	2.2	2.2	scaffold_1	780	824	(13396)	(ATAATA)n	Simple_repeat	1	45	(0)	2

diff --git a/tools/repeatmasker/test-data/small_dfam_rattus.fasta.stats b/tools/repeatmasker/test-data/small_dfam_rattus.fasta.stats
@@ -14,6 +14,7 @@ SINEs:                 0            0 bp    0.00 %
       IDs              0            0 bp    0.00 %
       MIRs             0            0 bp    0.00 %
 
+
 LINEs:                 0            0 bp    0.00 %
       LINE1            0            0 bp    0.00 %
       LINE2            0            0 bp    0.00 %
@@ -47,7 +48,7 @@ Low complexity:        0            0 bp    0.00 %
 
 
 The query species was assumed to be rattus        
-RepeatMasker version 4.1.2-p1 , default mode
-
-run with rmblastn version 2.10.0+
-FamDB: CONS-Dfam_3.3
+RepeatMasker version 4.1.5 , default mode
+                                        
+run with rmblastn version 2.13.0+
+FamDB: CONS-Dfam_3.7