Language editing

Co-authored-by: Marius van den Beek <[email protected]>
galaxyproject · Sep 15, 2023 · c159c3d · c159c3d
1 parent 4b8a94c
commit c159c3d
Show file tree

Hide file tree

Showing 8 changed files with 36 additions and 36 deletions.
diff --git a/workflows/transcriptomics/rnaseq-pe/CHANGELOG.md b/workflows/transcriptomics/rnaseq-pe/CHANGELOG.md
@@ -1,14 +1,14 @@
 # Changelog
 
-## [0.5] 2023-03-17
+## [0.5] 2023-09-15
 
 ### Automatic update
 - `toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.8a+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.10b+galaxy4`
 
 ### Manual update
-- Use STAR to compute normalized strand splitted coverage
-- Propose StringTie to compute FPKM etc...
-- Put cufflinks step optional
+- Use STAR to compute normalized strand-specific coverage
+- Add an option to use StringTie to compute FPKM
+- Make cufflinks step optional
 
 ## [0.4.1] 2023-09-14
 - add author in dockstore file

diff --git a/workflows/transcriptomics/rnaseq-pe/README.md b/workflows/transcriptomics/rnaseq-pe/README.md
@@ -17,24 +17,24 @@ chrM	chrM_gene	exon	0	16299	.	-	.	gene_id "chrM_gene_minus"; transcript_id "chrM
 
 - adapter sequences: this depends on the library preparation. Usually classical Illumina RNA libraries are Truseq and ISML (relatively new Illumina library) is Nextera. If you don't know, use FastQC to determine if it is Truseq or Nextera. If the read length is relatively short (50bp), there is probably no adapter so it will not impact your results.
 - reference_genome: this field will be adapted to the genomes available for STAR
-- strandness: For stranded RNA, reverse means that the first read in pair is complementary to the coding sequence, forward means that the first read in pair is in the same orientation as the coding sequence. This will help you to get from STAR only the counts corresponding to your library preparation. This is also used for the stranded coverage and for FPKM computation with cufflinks/StringTie.
+- strandedness: For stranded RNA, reverse means that the first read in a pair is complementary to the coding sequence, forward means that the first read in a pair is in the same orientation as the coding sequence. This will only count alignments that are compatible with your library preparation strategy. This is also used for the stranded coverage and for FPKM computation with cufflinks/StringTie.
 - cufflinks_FPKM: Whether you want to get FPKM with Cufflinks (pretty long)
 - stringtie_FPKM: Whether you want to get FPKM/TPM etc... with StringTie.
 
 ## Processing
 
 - The workflow will remove adapters and low quality bases and filter out any read smaller than 15bp.
-- The filtered reads are mapped with STAR with ENCODE parameters (for long RNA-seq but I use it for short also). STAR is also used to count reads per gene and generate stranded specific normalized coverage (on uniquely mapped reads).
-- A multiQC is run to have an overview of the QC. This can also be used to get the strandness.
+- The filtered reads are mapped with STAR with ENCODE parameters (for long RNA-seq but I use it for short also). STAR is also used to count reads per gene and generate strand-specific normalized coverage (on uniquely mapped reads).
+- A multiQC is run to have an overview of the QC. This can also be used to get the strandedness.
 - FPKM values for genes and transcripts are computed with cufflinks using correction for multi-mapped reads (this step is optionnal).
 - FPKM/TPM values for genes are computed with StringTie.
 - The BAM is filtered to keep only uniquely mapped reads (tag NH:i:1).
-- Coverage unstranded is computed with bedtools and normalized to the number of million uniquely mapped reads.
+- Unstranded coverage is computed with bedtools and normalized to the number of million uniquely mapped reads.
 - The three coverage files are converted to bigwig.
 
 ### Warning
 
-- The coverage stranded output depends on the strandness of the library:
+- The coverage stranded output depends on the strandedness of the library:
   - If you have an unstranded library, stranded coverages are useless
   - If you have a forward stranded library, the label matches the orientation of the first read in pairs.
   - If you have a reverse stranded library, the label matches the orientation of the second read in pairs.
diff --git a/workflows/transcriptomics/rnaseq-pe/rnaseq-pe-tests.yml b/workflows/transcriptomics/rnaseq-pe/rnaseq-pe-tests.yml
@@ -23,7 +23,7 @@
     forward_adapter: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
     reverse_adapter: GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
     reference_genome: dm6
-    strandness: unstranded
+    strandedness: unstranded
     cufflinks_FPKM: false
     stringtie_FPKM: true
   outputs:

diff --git a/workflows/transcriptomics/rnaseq-pe/rnaseq-pe.ga b/workflows/transcriptomics/rnaseq-pe/rnaseq-pe.ga
@@ -157,10 +157,10 @@
             "inputs": [
                 {
                     "description": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence",
-                    "name": "strandness"
+                    "name": "strandedness"
                 }
             ],
-            "label": "strandness",
+            "label": "strandedness",
             "name": "Input parameter",
             "outputs": [],
             "position": {
@@ -470,7 +470,7 @@
                 }
             },
             "inputs": [],
-            "label": "Get Stringtie strandness parameter",
+            "label": "Get Stringtie strandedness parameter",
             "name": "Map parameter value",
             "outputs": [
                 {
@@ -1047,7 +1047,7 @@
                     "input_subworkflow_step_id": 2,
                     "output_name": "signal_unique_str2"
                 },
-                "strandness": {
+                "strandedness": {
                     "id": 5,
                     "input_subworkflow_step_id": 0,
                     "output_name": "output"
@@ -1084,10 +1084,10 @@
                         "inputs": [
                             {
                                 "description": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence",
-                                "name": "strandness"
+                                "name": "strandedness"
                             }
                         ],
-                        "label": "strandness",
+                        "label": "strandedness",
                         "name": "Input parameter",
                         "outputs": [],
                         "position": {
@@ -1758,7 +1758,7 @@
                     "id": 14,
                     "output_name": "mapped_reads"
                 },
-                "rna_strandness": {
+                "rna_strandedness": {
                     "id": 13,
                     "output_name": "output_param_text"
                 },
@@ -1803,7 +1803,7 @@
                 "owner": "iuc",
                 "tool_shed": "toolshed.g2.bx.psu.edu"
             },
-            "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"adv\": {\"abundance_estimation\": true, \"omit_sequences\": \"\", \"name_prefix\": null, \"fraction\": \"0.01\", \"min_tlen\": \"200\", \"min_anchor_len\": \"10\", \"min_anchor_cov\": \"1\", \"min_bundle_cov\": \"1\", \"bdist\": \"50\", \"bundle_fraction\": \"1.0\", \"disable_trimming\": false, \"multi_mapping\": false, \"point_features\": {\"__class__\": \"RuntimeValue\"}}, \"guide\": {\"use_guide\": \"yes\", \"__current_case__\": 1, \"guide_source\": {\"guide_gff_select\": \"history\", \"__current_case__\": 1, \"ref_hist\": {\"__class__\": \"ConnectedValue\"}}, \"input_estimation\": true, \"special_outputs\": {\"special_outputs_select\": \"no\", \"__current_case__\": 2}, \"coverage_file\": false}, \"input_options\": {\"input_mode\": \"short_reads\", \"__current_case__\": 0, \"input_bam\": {\"__class__\": \"ConnectedValue\"}}, \"rna_strandness\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"adv\": {\"abundance_estimation\": true, \"omit_sequences\": \"\", \"name_prefix\": null, \"fraction\": \"0.01\", \"min_tlen\": \"200\", \"min_anchor_len\": \"10\", \"min_anchor_cov\": \"1\", \"min_bundle_cov\": \"1\", \"bdist\": \"50\", \"bundle_fraction\": \"1.0\", \"disable_trimming\": false, \"multi_mapping\": false, \"point_features\": {\"__class__\": \"RuntimeValue\"}}, \"guide\": {\"use_guide\": \"yes\", \"__current_case__\": 1, \"guide_source\": {\"guide_gff_select\": \"history\", \"__current_case__\": 1, \"ref_hist\": {\"__class__\": \"ConnectedValue\"}}, \"input_estimation\": true, \"special_outputs\": {\"special_outputs_select\": \"no\", \"__current_case__\": 2}, \"coverage_file\": false}, \"input_options\": {\"input_mode\": \"short_reads\", \"__current_case__\": 0, \"input_bam\": {\"__class__\": \"ConnectedValue\"}}, \"rna_strandedness\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
             "tool_version": "2.2.1+galaxy1",
             "type": "tool",
             "uuid": "4c7d6852-faac-4269-a7fa-92f93ebdab4c",

diff --git a/workflows/transcriptomics/rnaseq-sr/CHANGELOG.md b/workflows/transcriptomics/rnaseq-sr/CHANGELOG.md
@@ -1,14 +1,14 @@
 # Changelog
 
-## [0.5] 2023-03-17
+## [0.5] 2023-09-15
 
 ### Automatic update
 - `toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.8a+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.10b+galaxy4`
 
 ### Manual update
-- Use STAR to compute normalized strand splitted coverage
-- Propose StringTie to compute FPKM etc...
-- Put cufflinks step optional
+- Use STAR to compute normalized strand-specific coverage
+- Add an option to use StringTie to compute FPKM
+- Make cufflinks step optional
 
 ## [0.4.1] 2023-09-14
 - add author in dockstore file

diff --git a/workflows/transcriptomics/rnaseq-sr/README.md b/workflows/transcriptomics/rnaseq-sr/README.md
@@ -17,24 +17,24 @@ chrM	chrM_gene	exon	0	16299	.	-	.	gene_id "chrM_gene_minus"; transcript_id "chrM
 
 - forward adapter sequence: this depends on the library preparation. Usually classical Illumina RNA libraries are Truseq and ISML (relatively new Illumina library) is Nextera. If you don't know, use FastQC to determine if it is Truseq or Nextera. If the read length is relatively short (50bp), there is probably no adapter so it will not impact your results.
 - reference_genome: this field will be adapted to the genomes available for STAR
-- strandness: For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence. This will help you to get from STAR only the counts corresponding to your library preparation. This is also used for the stranded coverage and for FPKM computation with cufflinks/StringTie.
+- strandedness: For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence. This will only count alignments that are compatible with your library preparation strategy. This is also used for the stranded coverage and for FPKM computation with cufflinks/StringTie.
 - cufflinks_FPKM: Whether you want to get FPKM with Cufflinks (pretty long)
 - stringtie_FPKM: Whether you want to get FPKM/TPM etc... with Stringtie.
 
 ## Processing
 
 - The workflow will remove adapters and low quality bases and filter out any read smaller than 15bp.
-- The filtered reads are mapped with STAR with ENCODE parameters (for long RNA-seq but I use it for short also). STAR is also used to count reads per gene and generate stranded specific normalized coverage (on uniquely mapped reads).
-- A multiQC is run to have an overview of the QC. This can also be used to get the strandness.
+- The filtered reads are mapped with STAR with ENCODE parameters (for long RNA-seq but I use it for short also). STAR is also used to count reads per gene and generate strand-specific normalized coverage (on uniquely mapped reads).
+- A multiQC is run to have an overview of the QC. This can also be used to get the strandedness.
 - FPKM values for genes and transcripts are computed with cufflinks using correction for multi-mapped reads (this step is optionnal).
 - FPKM/TPM values for genes are computed with StringTie (this step is optional).
 - The BAM is filtered to keep only uniquely mapped reads (tag NH:i:1).
-- Coverage unstranded is computed with bedtools and normalized to the number of million uniquely mapped reads.
+- Unstranded coverage is computed with bedtools and normalized to the number of million uniquely mapped reads.
 - The three coverage files are converted to bigwig.
 
 ### Warning
 
-- The coverage stranded output depends on the strandness of the library:
+- The coverage stranded output depends on the strandedness of the library:
   - If you have an unstranded library, stranded coverages are useless
   - If you have a forward stranded library, the label matches the orientation of reads.
   - If you have a reverse stranded library, `forward` should correspond to genes on the forward strand and uses the reads mapped on the reverse strand. `reverse` should correspond to genes on the reverse strand and uses the reads mapped on the forward strand.

diff --git a/workflows/transcriptomics/rnaseq-sr/rnaseq-sr-tests.yml b/workflows/transcriptomics/rnaseq-sr/rnaseq-sr-tests.yml
@@ -13,7 +13,7 @@
         location: https://zenodo.org/record/4541751/files/GSM461177_1_subsampled.fastqsanger
     forward_adapter: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
     reference_genome: dm6
-    strandness: unstranded
+    strandedness: unstranded
     cufflinks_FPKM: true
     stringtie_FPKM: true
   outputs:

diff --git a/workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga b/workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga
@@ -130,10 +130,10 @@
             "inputs": [
                 {
                     "description": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence",
-                    "name": "strandness"
+                    "name": "strandedness"
                 }
             ],
-            "label": "strandness",
+            "label": "strandedness",
             "name": "Input parameter",
             "outputs": [],
             "position": {
@@ -444,7 +444,7 @@
                 }
             },
             "inputs": [],
-            "label": "Get Stringtie strandness parameter",
+            "label": "Get Stringtie strandedness parameter",
             "name": "Map parameter value",
             "outputs": [
                 {
@@ -1026,7 +1026,7 @@
                     "input_subworkflow_step_id": 2,
                     "output_name": "signal_unique_str2"
                 },
-                "strandness": {
+                "strandedness": {
                     "id": 4,
                     "input_subworkflow_step_id": 0,
                     "output_name": "output"
@@ -1063,10 +1063,10 @@
                         "inputs": [
                             {
                                 "description": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence",
-                                "name": "strandness"
+                                "name": "strandedness"
                             }
                         ],
-                        "label": "strandness",
+                        "label": "strandedness",
                         "name": "Input parameter",
                         "outputs": [],
                         "position": {
@@ -1737,7 +1737,7 @@
                     "id": 13,
                     "output_name": "mapped_reads"
                 },
-                "rna_strandness": {
+                "rna_strandedness": {
                     "id": 12,
                     "output_name": "output_param_text"
                 },
@@ -1782,7 +1782,7 @@
                 "owner": "iuc",
                 "tool_shed": "toolshed.g2.bx.psu.edu"
             },
-            "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"adv\": {\"abundance_estimation\": true, \"omit_sequences\": \"\", \"name_prefix\": null, \"fraction\": \"0.01\", \"min_tlen\": \"200\", \"min_anchor_len\": \"10\", \"min_anchor_cov\": \"1\", \"min_bundle_cov\": \"1\", \"bdist\": \"50\", \"bundle_fraction\": \"1.0\", \"disable_trimming\": false, \"multi_mapping\": false, \"point_features\": {\"__class__\": \"RuntimeValue\"}}, \"guide\": {\"use_guide\": \"yes\", \"__current_case__\": 1, \"guide_source\": {\"guide_gff_select\": \"history\", \"__current_case__\": 1, \"ref_hist\": {\"__class__\": \"ConnectedValue\"}}, \"input_estimation\": true, \"special_outputs\": {\"special_outputs_select\": \"no\", \"__current_case__\": 2}, \"coverage_file\": false}, \"input_options\": {\"input_mode\": \"short_reads\", \"__current_case__\": 0, \"input_bam\": {\"__class__\": \"ConnectedValue\"}}, \"rna_strandness\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"adv\": {\"abundance_estimation\": true, \"omit_sequences\": \"\", \"name_prefix\": null, \"fraction\": \"0.01\", \"min_tlen\": \"200\", \"min_anchor_len\": \"10\", \"min_anchor_cov\": \"1\", \"min_bundle_cov\": \"1\", \"bdist\": \"50\", \"bundle_fraction\": \"1.0\", \"disable_trimming\": false, \"multi_mapping\": false, \"point_features\": {\"__class__\": \"RuntimeValue\"}}, \"guide\": {\"use_guide\": \"yes\", \"__current_case__\": 1, \"guide_source\": {\"guide_gff_select\": \"history\", \"__current_case__\": 1, \"ref_hist\": {\"__class__\": \"ConnectedValue\"}}, \"input_estimation\": true, \"special_outputs\": {\"special_outputs_select\": \"no\", \"__current_case__\": 2}, \"coverage_file\": false}, \"input_options\": {\"input_mode\": \"short_reads\", \"__current_case__\": 0, \"input_bam\": {\"__class__\": \"ConnectedValue\"}}, \"rna_strandedness\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
             "tool_version": "2.2.1+galaxy1",
             "type": "tool",
             "uuid": "4c7d6852-faac-4269-a7fa-92f93ebdab4c",