feat: add cram and fcs (#127)

* feat: add cram and fcs
* fix: bad name

Cargo.toml

@@ -10,7 +10,7 @@ name = "biobear"
 [dependencies]
 arrow = { version = "51.0.0", features = ["pyarrow"] }
 datafusion = "37"
-exon = { version = "0.18.0", features = ["default"] }
+exon = { version = "0.19.1", features = ["default"] }
 pyo3 = "0.20"
 tokio = { version = "1", features = ["rt"] }
 noodles = { version = "0.70", features = ["core"] }

python/biobear/__init__.py

@@ -40,6 +40,8 @@
 from .biobear import HMMDomTabReadOptions
 from .biobear import MzMLReadOptions
 from .biobear import GenBankReadOptions
+from .biobear import FCSReadOptions
+from .biobear import CRAMReadOptions
 from .biobear import connect
 from .biobear import new_session
 from .biobear import __runtime
@@ -68,6 +70,8 @@
     "BCFReadOptions",
     "VCFReadOptions",
     "BEDReadOptions",
+    "FCSReadOptions",
+    "CRAMReadOptions",
     "BigWigReadOptions",
     "SAMReadOptions",
     "BAMReadOptions",

python/biobear/biobear.pyi

@@ -15,6 +15,21 @@ class FileCompressionType(enum.Enum):
     BGZIP = 1
     NONE = 2
 
+class CRAMReadOptions:
+    def __init__(
+        self,
+        /,
+        region: Optional[str] = None,
+        fasta_reference: Optional[str] = None,
+    ) -> None: ...
+
+class FCSReadOptions:
+    def __init__(
+        self,
+        /,
+        file_compression_type: Optional[FileCompressionType] = None,
+    ) -> None: ...
+
 class HMMDomTabReadOptions:
     def __init__(
         self,
@@ -90,6 +105,8 @@ class BAMReadOptions:
 class BEDReadOptions:
     def __init__(
         self,
+        /,
+        file_compression_type: Optional[FileCompressionType] = None,
     ) -> None: ...
 
 class BigWigReadOptions:
@@ -154,6 +171,12 @@ class BioBearSessionContext:
     def read_genbank_file(
         self, file_path: str, /, options: Optional[GenBankReadOptions]
     ) -> ExecutionResult: ...
+    def read_cram_file(
+        self, file_path: str, /, options: Optional[CRAMReadOptions]
+    ) -> ExecutionResult: ...
+    def read_fcs_file(
+        self, file_path: str, /, options: Optional[FCSReadOptions]
+    ) -> ExecutionResult: ...
     def sql(self, query: str) -> ExecutionResult: ...
     def execute(self, query: str) -> None: ...
 

python/tests/data/cram/ce.fa.fai

@@ -0,0 +1,7 @@
+CHROMOSOME_I	1009800	14	50	51
+CHROMOSOME_II	5000	1030025	50	51
+CHROMOSOME_III	5000	1035141	50	51
+CHROMOSOME_IV	5000	1040256	50	51
+CHROMOSOME_V	5000	1045370	50	51
+CHROMOSOME_X	5000	1050484	50	51
+CHROMOSOME_MtDNA	5000	1055602	50	51

python/tests/data/two-cram/rand1k.fa

@@ -0,0 +1,18 @@
+>rand1k
+TCCTAATTCTGGGTAACCGCCGCCTGAAGCCAAAAAATAAGCCGGAGCCAAGGGGGAGTC
+ACACTGCTCCACGAACGCCTCTCATACAGCTTCGTCTTACAGGTGGAGATCATTGTCCCG
+GAGAGTCATGTGCCTTAGTTAAAAAGGTTTACTGCGCTCGGGGTCGAGTGCGGGAACTTC
+TCGGGTGGCTACGTACCGGGGCCTACCTTGCTATCTTTGACAATCAGCGTTCTGGATTGT
+CAGGCTCACTTCCGTAGCAGTTGCTGGAGAATATGGACATATCAGCTTTGACACACTGGG
+TTAAGGCGTAGGGTAGAGACGGAGTCCCTTCGCTGCCAATGTGGTGGTTTGGGACGAGTA
+TCATGTTGGTGCCCCAAGTTAACTTACTCCGCCCATGTCGTGCGATTACGCGAGAGTAGT
+AGATCGCTACGAGTATGTCCTCGGTGATCTAGTTAACTACTGTTACTGATGTCCGTTGCT
+CCACAGGTATACTCGGACACAATTCACGGGCTCCTCAAGCATACTAAAGAAGTCACGAGT
+GACGTCGGCGTAACCTCACATTAGTGGAGGAACCCGTGTGGAACATCATTCTAACGACAC
+TGTCGATCCCGGATGGATATGGTAGTCTTGATTATCCAGAGTCTTAGAGACATGGTAAGT
+TAGGAGCGCAGGACCATCAACTCTACTTTCCGGCAAATGTTAAGGGGTTTTGCTGACCAC
+CCGCATGCTTACAGTCCCGTTTCGCTAAGGTCTTCCTCGCTGCCTCTAGTTTTAGCGGAC
+GTTCCTTTCTCAACTAGTCTATTTGTTCATACTCATTTGGCACAGGTCTGTGTACGTCTA
+TCATGCGGACTAAATTACCCACAGAATGTCACAGGACAACATAGTGTTCATCATCCCTGT
+GGGATAACCGGTTACCTCGGATGAGGAGTATGAACTATATCTTAGCGTAGACCGATGTAT
+GGAAAGGCGCAGCCTCTGGCCGCCCACTATCGGAAATCGT

python/tests/data/two-cram/rand1k.fa.fai

@@ -0,0 +1 @@
+rand1k	1000	9	60	61

python/tests/test_session.py

@@ -28,6 +28,7 @@
     VCFReadOptions,
     GTFReadOptions,
     MzMLReadOptions,
+    CRAMReadOptions,
     new_session,
 )
 
@@ -499,3 +500,31 @@ def test_genbank_reader():
     df = result.to_polars()
 
     assert len(df) == 1
+
+
+@pytest.mark.skipif(
+    not importlib.util.find_spec("polars"), reason="polars not installed"
+)
+def test_cram_reader():
+    session = new_session()
+
+    result = session.read_cram_file((DATA / "cram" / "test_input_1_a.cram").as_posix())
+
+    assert len(result.to_polars()) == 15
+
+
+@pytest.mark.skipif(
+    not importlib.util.find_spec("polars"), reason="polars not installed"
+)
+def test_cram_reader_with_region():
+    session = new_session()
+
+    fasta_reference = (DATA / "two-cram" / "rand1k.fa").as_posix()
+    options = CRAMReadOptions(region="1", fasta_reference=fasta_reference)
+
+    result = session.read_cram_file(
+        (DATA / "two-cram" / "twolib.sorted.cram").as_posix(),
+        options=options,
+    )
+
+    assert len(result.to_polars()) == 0

src/datasources/bam.rs

@@ -12,12 +12,12 @@
 // See the License for the specific language governing permissions and
 // limitations under the License.
 
-use std::str::FromStr;
-
 use exon::datasources::bam::table_provider::ListingBAMTableOptions;
 use noodles::core::Region;
 use pyo3::{pyclass, pymethods, PyResult};
 
+use super::parse_region;
+
 #[pyclass]
 #[derive(Debug, Clone, Default)]
 pub struct BAMReadOptions {
@@ -28,15 +28,7 @@ pub struct BAMReadOptions {
 impl BAMReadOptions {
     #[new]
     pub fn try_new(region: Option<String>) -> PyResult<Self> {
-        let region = region
-            .map(|r| Region::from_str(&r))
-            .transpose()
-            .map_err(|e| {
-                crate::error::BioBearError::ParserError(format!(
-                    "Couldn\'t parse region error {}",
-                    e
-                ))
-            })?;
+        let region = parse_region(region)?;
 
         Ok(Self { region })
     }

src/datasources/cram.rs

@@ -0,0 +1,52 @@
+// Copyright 2024 WHERE TRUE Technologies.
+//
+// Licensed under the Apache License, Version 2.0 (the "License");
+// you may not use this file except in compliance with the License.
+// You may obtain a copy of the License at
+//
+//     http://www.apache.org/licenses/LICENSE-2.0
+//
+// Unless required by applicable law or agreed to in writing, software
+// distributed under the License is distributed on an "AS IS" BASIS,
+// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+// See the License for the specific language governing permissions and
+// limitations under the License.
+
+use exon::datasources::cram;
+use noodles::core::Region;
+use pyo3::{pyclass, pymethods, PyResult};
+
+use super::parse_region;
+
+#[pyclass]
+#[derive(Debug, Clone, Default)]
+pub struct CRAMReadOptions {
+    region: Option<Region>,
+    fasta_reference: Option<String>,
+}
+
+#[pymethods]
+impl CRAMReadOptions {
+    #[new]
+    pub fn try_new(region: Option<String>, fasta_reference: Option<String>) -> PyResult<Self> {
+        let region = parse_region(region)?;
+
+        Ok(Self {
+            region,
+            fasta_reference,
+        })
+    }
+}
+
+impl From<CRAMReadOptions> for cram::table_provider::ListingCRAMTableOptions {
+    fn from(options: CRAMReadOptions) -> Self {
+        let mut t = cram::table_provider::ListingCRAMTableOptions::default()
+            .with_fasta_reference(options.fasta_reference);
+
+        if let Some(region) = options.region {
+            t = t.with_region(Some(region)).with_indexed(true);
+        }
+
+        t
+    }
+}

src/datasources/fcs.rs

@@ -0,0 +1,42 @@
+// Copyright 2024 WHERE TRUE Technologies.
+//
+// Licensed under the Apache License, Version 2.0 (the "License");
+// you may not use this file except in compliance with the License.
+// You may obtain a copy of the License at
+//
+//     http://www.apache.org/licenses/LICENSE-2.0
+//
+// Unless required by applicable law or agreed to in writing, software
+// distributed under the License is distributed on an "AS IS" BASIS,
+// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+// See the License for the specific language governing permissions and
+// limitations under the License.
+
+use exon::datasources::fcs::table_provider::ListingFCSTableOptions;
+use pyo3::{pyclass, pymethods};
+
+use crate::FileCompressionType;
+
+#[pyclass]
+#[derive(Debug, Clone, Default)]
+pub struct FCSReadOptions {
+    // File compression type
+    file_compression_type: FileCompressionType,
+}
+
+#[pymethods]
+impl FCSReadOptions {
+    #[new]
+    pub fn new(file_compression_type: Option<FileCompressionType>) -> Self {
+        Self {
+            file_compression_type: file_compression_type.unwrap_or_default(),
+        }
+    }
+}
+
+impl From<FCSReadOptions> for ListingFCSTableOptions {
+    fn from(options: FCSReadOptions) -> Self {
+        ListingFCSTableOptions::default()
+            .with_file_compression_type(options.file_compression_type.into())
+    }
+}

src/datasources/mod.rs

@@ -15,15 +15,16 @@
 use std::str::FromStr;
 
 use noodles::core::Region;
-
-use crate::error::BioBearResult;
+use pyo3::PyResult;
 
 pub mod bam;
 pub mod bcf;
 pub mod bed;
 pub mod bigwig;
+pub mod cram;
 pub mod fasta;
 pub mod fastq;
+pub mod fcs;
 pub mod genbank;
 pub mod gff;
 pub mod gtf;
@@ -32,7 +33,7 @@ pub mod mzml;
 pub mod sam;
 pub mod vcf;
 
-pub(crate) fn parse_region(region: Option<String>) -> BioBearResult<Option<noodles::core::Region>> {
+pub(crate) fn parse_region(region: Option<String>) -> PyResult<Option<noodles::core::Region>> {
     let region = region
         .map(|r| Region::from_str(&r))
         .transpose()

src/lib.rs

@@ -66,6 +66,8 @@ fn biobear(_py: Python, m: &PyModule) -> PyResult<()> {
     m.add_class::<datasources::mzml::MzMLReadOptions>()?;
     m.add_class::<datasources::hmm_dom_tab::HMMDomTabReadOptions>()?;
     m.add_class::<datasources::genbank::GenBankReadOptions>()?;
+    m.add_class::<datasources::cram::CRAMReadOptions>()?;
+    m.add_class::<datasources::fcs::FCSReadOptions>()?;
 
     m.add_function(wrap_pyfunction!(session_context::connect, m)?)?;
     m.add_function(wrap_pyfunction!(session_context::new_session, m)?)?;

src/session_context.rs

@@ -157,6 +157,22 @@ impl BioBearSessionContext {
         Ok(PyExecutionResult::new(df))
     }
 
+    /// Read a CRAM file from the given path.
+    #[pyo3(signature = (file_path, /, options=None))]
+    fn read_cram_file(
+        &mut self,
+        file_path: &str,
+        options: Option<crate::datasources::cram::CRAMReadOptions>,
+        py: Python,
+    ) -> PyResult<PyExecutionResult> {
+        let options = options.unwrap_or_default();
+
+        let result = self.ctx.read_cram(file_path, options.into());
+        let df = wait_for_future(py, result).map_err(error::BioBearError::from)?;
+
+        Ok(PyExecutionResult::new(df))
+    }
+
     /// Read a mzml file from the given path.
     #[pyo3(signature = (file_path, /, options=None))]
     fn read_mzml_file(