Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Run lsp formatting #180

Merged
merged 2 commits into from
Dec 22, 2024
Merged

Run lsp formatting #180

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
2 commits
Select commit Hold shift + click to select a range
ba48eb2
chore: Fix pipeline => nascent
edmundmiller Dec 21, 2024
e6b3ecd
style: First pass with lsp
edmundmiller Nov 4, 2024
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
20 changes: 10 additions & 10 deletions conf/test.config
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -24,30 +24,30 @@ params {

// Input data
// TODO params.pipelines_testdata_base_path + 'viralrecon/samplesheet/samplesheet_test_illumina_amplicon.csv'
input = "${projectDir}/assets/samplesheet.csv"
input = "${projectDir}/assets/samplesheet.csv"

// Genome references
fasta = 'https://raw.githubusercontent.com/nf-core/test-datasets/nascent/reference/GRCh38_chr21.fa'
gtf = 'https://raw.githubusercontent.com/nf-core/test-datasets/nascent/reference/genes_chr21.gtf'
hisat2_index = 'https://raw.githubusercontent.com/nf-core/test-datasets/nascent/reference/GRCh38_chr21_hisat2.tar.gz'
fasta = 'https://raw.githubusercontent.com/nf-core/test-datasets/nascent/reference/GRCh38_chr21.fa'
gtf = 'https://raw.githubusercontent.com/nf-core/test-datasets/nascent/reference/genes_chr21.gtf'
hisat2_index = 'https://raw.githubusercontent.com/nf-core/test-datasets/nascent/reference/GRCh38_chr21_hisat2.tar.gz'

assay_type = "GROseq"
skip_grohmm = true // FIXME Fails due to higher memory requirements
assay_type = "GROseq"
// FIXME Fails due to higher memory requirements
skip_grohmm = true
grohmm_min_uts = 5
grohmm_max_uts = 10
grohmm_min_ltprobb = -100
grohmm_max_ltprobb = -150
filter_bed = "${projectDir}/tests/config/unwanted_region.bed"
intersect_bed = "${projectDir}/tests/config/wanted_region.bed"
filter_bed = "${projectDir}/tests/config/unwanted_region.bed"
intersect_bed = "${projectDir}/tests/config/wanted_region.bed"
}

process {
withName: STAR_GENOMEGENERATE {
ext.args = '--genomeSAindexNbases 9'
}

withName: 'PINTS_CALLER' {
// HACK Tests fail after latest modules update
withName: PINTS_CALLER {
ext.args = { "--disable-small" }
}
}
14 changes: 7 additions & 7 deletions conf/test_copro.config
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -15,17 +15,17 @@ params {
config_profile_description = 'Test dataset to check PINTS pipeline function(https://pints.yulab.org/tre_calling#part-iv-case-2)'

// Input data
input = "${projectDir}/tests/config/samplesheets/copro.csv"
input = "${projectDir}/tests/config/samplesheets/copro.csv"

genome = 'hg38'
assay_type = 'CoPRO'
filter_bed = "https://pints.yulab.org/ref/examples/promoters_1kb_tss_centered.bed.gz"
with_umi = true
umitools_dedup_stats = true
genome = 'hg38'
assay_type = 'CoPRO'
filter_bed = "https://pints.yulab.org/ref/examples/promoters_1kb_tss_centered.bed.gz"
with_umi = true
umitools_dedup_stats = true
}

process {
withName: NFCORE_NASCENT:NASCENT:FASTP {
withName: FASTP {
ext.args = [
"--adapter_sequence TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC",
"--adapter_sequence_r2 GATCGTCGGACTGTAGAACTCTGAAC",
Expand Down
6 changes: 3 additions & 3 deletions conf/test_full.config
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -16,9 +16,9 @@ params {

// Input data for full size test
// TODO params.pipelines_testdata_base_path + 'viralrecon/samplesheet/samplesheet_full_illumina_amplicon.csv'
input = "${projectDir}/assets/samplesheet_full.csv"
input = "${projectDir}/assets/samplesheet_full.csv"

// Genome references
genome = 'hg38'
assay_type = 'GROseq'
genome = 'hg38'
assay_type = 'GROseq'
}
19 changes: 10 additions & 9 deletions conf/test_grocap.config
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -15,21 +15,22 @@ params {
config_profile_description = 'Test dataset to check PINTS pipeline function(https://pints.yulab.org/tre_calling#part-iii-case-1)'

// Input data
input = "${projectDir}/tests/config/samplesheets/grocap.csv"
input = "${projectDir}/tests/config/samplesheets/grocap.csv"

genome = 'hg38'
assay_type = 'GROcap'
filter_bed = "https://pints.yulab.org/ref/examples/promoters_1kb_tss_centered.bed.gz"
genome = 'hg38'
assay_type = 'GROcap'
filter_bed = "https://pints.yulab.org/ref/examples/promoters_1kb_tss_centered.bed.gz"
}

process {
withName: NFCORE_NASCENT:NASCENT:FASTP {
// only keep reads longer than 14nts after trimming
// This library was polyadenylated,
// so we are trimming the last 20nts per reads (with --trim_tail1).
// For more recent single-end PRO/GRO-cap libraries, this may not be necessary.
withName: 'NFCORE_NASCENT:NASCENT:FASTP' {
ext.args = [
"--adapter_sequence TGGAATTCTCGGGTGCCAAGG",
"-l 14", // only keep reads longer than 14nts after trimming
// This library was polyadenylated,
// so we are trimming the last 20nts per reads (with --trim_tail1).
// For more recent single-end PRO/GRO-cap libraries, this may not be necessary.
"-l 14",
"--trim_tail1 20",
"--low_complexity_filter",
"-w 8"
Expand Down
10 changes: 5 additions & 5 deletions modules/local/bed2saf.nf
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,11 +1,11 @@
process BED2SAF {
tag "$meta.id"
tag "${meta.id}"
label 'process_single'

conda "conda-forge::gawk=5.1.0"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/ubuntu:20.04' :
'nf-core/ubuntu:20.04' }"
container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container
? 'https://depot.galaxyproject.org/singularity/ubuntu:20.04'
: 'nf-core/ubuntu:20.04'}"

input:
tuple val(meta), path(bed)
Expand All @@ -20,7 +20,7 @@ process BED2SAF {
script:
"""
awk 'OFS="\\t" {print \$1"."\$2"."\$3, \$1, \$2, \$3, "."}' \\
$bed \\
${bed} \\
> ${bed.baseName}.saf

cat <<-END_VERSIONS > versions.yml
Expand Down
20 changes: 11 additions & 9 deletions modules/local/dreg_prep/main.nf
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,16 +1,16 @@
process DREG_PREP {

tag "$meta.id"
tag "${meta.id}"
label 'process_low'

conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/mulled-v2-f01e242bdea19948f0576fdca94777242fe4c2cb:4238fb992d2a93e648108c86e3a9f51348e834a9-0' :
'biocontainers/mulled-v2-f01e242bdea19948f0576fdca94777242fe4c2cb:4238fb992d2a93e648108c86e3a9f51348e834a9-0' }"
container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container
? 'https://depot.galaxyproject.org/singularity/mulled-v2-f01e242bdea19948f0576fdca94777242fe4c2cb:4238fb992d2a93e648108c86e3a9f51348e834a9-0'
: 'biocontainers/mulled-v2-f01e242bdea19948f0576fdca94777242fe4c2cb:4238fb992d2a93e648108c86e3a9f51348e834a9-0'}"

input:
tuple val(meta), path(bam_file), val(index)
path sizes
path sizes
val assay_type

output:
Expand Down Expand Up @@ -78,10 +78,11 @@ process DREG_PREP {

echo "bedGraph to bigwig done"
"""
} else {
}
else {
if (forwardStranded) {
"""
samtools view -@ $task.cpus -bf 0x2 ${bam_file} | samtools sort -n -@ $task.cpus \\
samtools view -@ ${task.cpus} -bf 0x2 ${bam_file} | samtools sort -n -@ ${task.cpus} \\
> ${prefix}.dreg.bam

bedtools bamtobed -bedpe -mate1 -i ${prefix}.dreg.bam \\
Expand Down Expand Up @@ -118,9 +119,10 @@ process DREG_PREP {
${prefix}.unsorted.bedGraph \\
> ${prefix}.bedGraph
"""
} else {
}
else {
"""
samtools view -@ $task.cpus -bf 0x2 ${bam_file} | samtools sort -n -@ $task.cpus \\
samtools view -@ ${task.cpus} -bf 0x2 ${bam_file} | samtools sort -n -@ ${task.cpus} \\
> ${prefix}.dreg.bam

bedtools bamtobed -bedpe -mate1 -i ${prefix}.dreg.bam \\
Expand Down
20 changes: 10 additions & 10 deletions modules/local/grohmm/parametertuning/main.nf
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,12 +1,12 @@
process GROHMM_PARAMETERTUNING {
tag "$meta.id|$UTS|$LtProbB"
tag "${meta.id}|${UTS}|${LtProbB}"
label 'process_high'
// array 10

conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b9/b929af5662486ba6ce2d27eb501e5c7ec71ca7dd8e333fe5d3dcf2803d87cf67/data' :
'community.wave.seqera.io/library/grohmm:833aa94cad4202ac' }"
container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container
? 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b9/b929af5662486ba6ce2d27eb501e5c7ec71ca7dd8e333fe5d3dcf2803d87cf67/data'
: 'community.wave.seqera.io/library/grohmm:833aa94cad4202ac'}"

input:
tuple val(meta), path(bams), path(bais), val(UTS), val(LtProbB)
Expand All @@ -15,7 +15,7 @@ process GROHMM_PARAMETERTUNING {
output:
tuple val(meta), path("*.tuning.csv"), emit: tuning
tuple val(meta), path("*.tuning.consensus.bed"), emit: bed
path "versions.yml", emit: versions
path "versions.yml", emit: versions

when:
task.ext.when == null || task.ext.when
Expand All @@ -27,12 +27,12 @@ process GROHMM_PARAMETERTUNING {
grohmm_parametertuning.R \\
--bam_file ${bams} \\
--outprefix ${prefix} \\
--gxf $gxf \\
--uts $UTS \\
--ltprobb $LtProbB \\
--gxf ${gxf} \\
--uts ${UTS} \\
--ltprobb ${LtProbB} \\
--outdir ./ \\
--cores $task.cpus \\
$args
--cores ${task.cpus} \\
${args}

cat <<-END_VERSIONS > versions.yml
"${task.process}":
Expand Down
24 changes: 12 additions & 12 deletions modules/local/grohmm/transcriptcalling/main.nf
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,25 +1,25 @@
process GROHMM_TRANSCRIPTCALLING {
tag "$meta.id"
tag "${meta.id}"
label 'process_high'
label 'process_long'

conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b9/b929af5662486ba6ce2d27eb501e5c7ec71ca7dd8e333fe5d3dcf2803d87cf67/data' :
'community.wave.seqera.io/library/grohmm:833aa94cad4202ac' }"
container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container
? 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b9/b929af5662486ba6ce2d27eb501e5c7ec71ca7dd8e333fe5d3dcf2803d87cf67/data'
: 'community.wave.seqera.io/library/grohmm:833aa94cad4202ac'}"

input:
tuple val(meta), path(bams), path(bais), path(tuning_file)
path gxf

output:
tuple val(meta), path("*.transcripts.txt"), emit: transcripts
tuple val(meta), path("*.eval.txt") , emit: eval
tuple val(meta), path("*.eval.txt"), emit: eval
tuple val(meta), path("*.transcripts.bed"), emit: transcripts_bed
tuple val(meta), path("*.tdFinal.txt") , emit: td
tuple val(meta), path("*.tdplot_mqc.png") , emit: td_plot
tuple val(meta), path("*.tdFinal_mqc.csv") , emit: mqc_csv
path "versions.yml" , emit: versions
tuple val(meta), path("*.tdFinal.txt"), emit: td
tuple val(meta), path("*.tdplot_mqc.png"), emit: td_plot
tuple val(meta), path("*.tdFinal_mqc.csv"), emit: mqc_csv
path "versions.yml", emit: versions

when:
task.ext.when == null || task.ext.when
Expand All @@ -32,11 +32,11 @@ process GROHMM_TRANSCRIPTCALLING {
--bam_file ${bams} \\
--tuning_file ${tuning_file} \\
--outprefix ${prefix} \\
--gxf $gxf \\
--gxf ${gxf} \\
--outdir ./ \\
--cores $task.cpus \\
--cores ${task.cpus} \\
--memory ${task.memory.toMega()} \\
$args
${args}

cat <<-END_VERSIONS > versions.yml
"${task.process}":
Expand Down
15 changes: 8 additions & 7 deletions modules/local/gtf2bed.nf
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,26 +1,27 @@
process GTF2BED {
tag "$gtf"
tag "${gtf}"
label 'process_low'

conda "conda-forge::perl=5.26.2"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/perl:5.26.2' :
'biocontainers/perl:5.26.2' }"
container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container
? 'https://depot.galaxyproject.org/singularity/perl:5.26.2'
: 'biocontainers/perl:5.26.2'}"

input:
path gtf

output:
path '*.bed' , emit: bed
path '*.bed', emit: bed
path "versions.yml", emit: versions

when:
task.ext.when == null || task.ext.when

script: // This script is bundled with the pipeline, in nf-core/nascent/bin/
script:
// This script is bundled with the pipeline, in nf-core/nascent/bin/
"""
gtf2bed \\
$gtf \\
${gtf} \\
> ${gtf.baseName}.bed

cat <<-END_VERSIONS > versions.yml
Expand Down
28 changes: 13 additions & 15 deletions subworkflows/local/align_bwamem2/main.nf
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -2,15 +2,15 @@
// Alignment with BWAMEM2
//

include { BWAMEM2_MEM } from '../../../modules/nf-core/bwamem2/mem/main'
include { BWAMEM2_MEM } from '../../../modules/nf-core/bwamem2/mem/main'
include { BAM_SORT_STATS_SAMTOOLS } from '../../nf-core/bam_sort_stats_samtools/main'

workflow ALIGN_BWAMEM2 {
take:
ch_reads // channel (mandatory): [ val(meta), [ path(reads) ] ]
ch_index // channel (mandatory): [ val(meta2), path(index) ]
val_sort_bam // boolean (mandatory): true or false
ch_fasta // channel (optional) : [ val(meta3), path(fasta) ]
ch_reads // channel (mandatory): [ val(meta), [ path(reads) ] ]
ch_index // channel (mandatory): [ val(meta2), path(index) ]
val_sort_bam // boolean (mandatory): true or false
ch_fasta // channel (optional) : [ val(meta3), path(fasta) ]

main:
ch_versions = Channel.empty()
Expand All @@ -19,25 +19,23 @@ workflow ALIGN_BWAMEM2 {
// Map reads with BWA
//

BWAMEM2_MEM ( ch_reads, ch_index, ch_fasta, val_sort_bam )
BWAMEM2_MEM(ch_reads, ch_index, ch_fasta, val_sort_bam)
ch_versions = ch_versions.mix(BWAMEM2_MEM.out.versions.first())

//
// Sort, index BAM file and run samtools stats, flagstat and idxstats
//

BAM_SORT_STATS_SAMTOOLS ( BWAMEM2_MEM.out.bam, ch_fasta )
BAM_SORT_STATS_SAMTOOLS(BWAMEM2_MEM.out.bam, ch_fasta)
ch_versions = ch_versions.mix(BAM_SORT_STATS_SAMTOOLS.out.versions)

emit:
bam_orig = BWAMEM2_MEM.out.bam // channel: [ val(meta), path(bam) ]

bam = BAM_SORT_STATS_SAMTOOLS.out.bam // channel: [ val(meta), path(bam) ]
bai = BAM_SORT_STATS_SAMTOOLS.out.bai // channel: [ val(meta), path(bai) ]
csi = BAM_SORT_STATS_SAMTOOLS.out.csi // channel: [ val(meta), path(csi) ]
stats = BAM_SORT_STATS_SAMTOOLS.out.stats // channel: [ val(meta), path(stats) ]
bam_orig = BWAMEM2_MEM.out.bam // channel: [ val(meta), path(bam) ]
bam = BAM_SORT_STATS_SAMTOOLS.out.bam // channel: [ val(meta), path(bam) ]
bai = BAM_SORT_STATS_SAMTOOLS.out.bai // channel: [ val(meta), path(bai) ]
csi = BAM_SORT_STATS_SAMTOOLS.out.csi // channel: [ val(meta), path(csi) ]
stats = BAM_SORT_STATS_SAMTOOLS.out.stats // channel: [ val(meta), path(stats) ]
flagstat = BAM_SORT_STATS_SAMTOOLS.out.flagstat // channel: [ val(meta), path(flagstat) ]
idxstats = BAM_SORT_STATS_SAMTOOLS.out.idxstats // channel: [ val(meta), path(idxstats) ]

versions = ch_versions // channel: [ path(versions.yml) ]
versions = ch_versions // channel: [ path(versions.yml) ]
}
Loading
Loading