Skip to content

dsNickFury is for comparing a CRISPR target site against all other potential sites in a genome. Orchid is a package I'm developing to go with it for iterative CRISPR analysis over an exome.

Notifications You must be signed in to change notification settings

michael-weinstein/dsNickFury3PlusOrchid

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

10 Commits
 
 
 
 
 
 

Repository files navigation

Elevation-search (aka dsNickFury3)

To perform efficient genomic searches for potential off-targets, we developed the program dsNickFury. This program can be used to locate every potential CRISPR/Cas9 target in a genome for a given sgRNA sequence, which can then be evaluated for on-target efficacy by our previously published model, Azimuth (Doench et al., Nature Biotechnology 2016), and for off-target effects by our new predictive model, Elevation (Listgarten et al., Nature Biomedical Engineering 2018).

See our manuscript or official project page for more detail.

Setup

Directory structure

When you first clone this repo, you will have the following folder structure:

dsnickfury/
    README.md
    dsNickFury3PlusOrchid/
    ...

Download data dependencies

All path names in the instructions assume the current working directory is the "dsnickfury" directory, i.e. the repo root.

To search the human (hg38) genome for potential off-target sites, you will also need to download the indexed genome data, available at the following link: http://download.microsoft.com/download/8/2/1/821D3094-7997-4B69-B221-573480A412E3/crispr_data.zip

Warning: the human genome data is large (~22GB)

Next, make a top-level directory for the data dependencies. Then you'll need to download the Elevation repository from the GitHub page:

git clone https://github.com/Microsoft/Elevation.git dependencies/elevation

Next, use the scripts in the Elevation repo to generate the data dependencies. The documentation for Elevation will walk you through this.

After generating the data dependencies, your directory structure should look like this:

dsnickfury/
    README.md
    dependencies/
        elevation/
            CRISPR/
            ..
    dsNickFury3PlusOrchid/
        genomes/
        ...

Installation of remaining code dependencies

The following dependencies are needed and should be put in the specified directories:

  • Azimuth 2.0.0 (from the public repo): git clone https://github.com/MicrosoftResearch/Azimuth.git dependencies/azimuth

Installation of Python dependencies

The main Elevation-search program code dsNickFury3.3.py runs on Python 3. Azimuth and Elevation (our on-target and off-target prediction models) run on Python 2. They will be invoked as sub-processes from Python 3.

Therefore, we need both Python 2 and 3 interpreters available at runtime.

Steps to set this up:

  1. Install anaconda2 into the dsnickfury/dependencies directory. You can do this directly on Linux by running the install script with the -p option, or on Windows using the graphical installer.

    All subsequent instructions refer to the anaconda2 installation in the dependencies directory.

  2. Install all Azimuth and Elevation dependencies using pip from the anaconda2 installation, e.g. dependencies/anaconda2/bin/pip install X or a similar command.

  3. Create a Python 3 environment using dependencies/anaconda2/bin/conda create -n dsNickFury python=3 and install all Python 3 dependencies (everything needed by dsNickFury3.3.py) using pip from the created environment, e.g. dependencies/anaconda2/envs/dsNickFury/bin/pip install X.

  4. The anaconda2 installation should now contain all third-party Python dependencies, as well as Python 2 and Python 3 interpreters.

    You should end up with the following folder structure:

dsnickfury
    dependencies
    anaconda2
    elevation
    azimuth
    CRISPR
dsNickFury3PlusOrchid
    genomes
    ...

Path Configuration

Modify the following line in settings.py to reflect the location of the dsNickFury repo.

network_root = "/home/jake/repos/"

If you followed the directory structure suggested above, the rest of the locations in settings.py should match your setup. At this point, you should be able to test the installation by running the commands in the section Test Commands.

Database Dependencies

ensemblGeneAnalyzer.py originally depended on Azure, but you can pass the -f flag to write results to stdout (or an output file, using the -o flag) instead.

To use Azure for storing the output:

  • pip install azure

  • write API key to azureTable.apikey. This is the file that will be accessed for the API key.

Test Commands

Debugging Model (invoke using python 2.7)

* `python predictionWrapper.py aggregation < test_aggregation.txt`
  (this tests the Elevation aggregation model)

* `python predictionWrapper.py elevation < test_elevation.txt`
  (this tests the Elevation-score model)

Debugging dsNickFury (invoke using python 3)

* `python dsNickFury3.3.py -m search -s CCTCTTTGACATCGTGTCCC_GGG -g HG38 --noElevation`
(this should return a perfectly matched site in TRPV4, and some other near-matches)

* `python dsNickFury3.3.py -m search -s TGGGGTGATTATGAGCACCG_AGG -g HG38 -p NGG --endClip 3`
(this should return a perfectly matched site in CD33, and give the
 Elevation-aggregate score for all of the listed mismatches. These are
 the same parameters that were used to populate the online database, so
 the score should match the score listed online for this guide)

* `python ensemblGeneAnalyzer.py --ensg ENSG00000105383 -f`
(this should find all guides that target protein-coding regions in CD33,
 and print a list of them to stdout, which can then be run through
 dsNickFury)

Usage details

About dsNickFury3:

Purpose: dsNickFury is a Python3 program to help select guide RNA sequences for use with any CRISPR/Cas system. This program can work with any system having activity sites defined by a guide RNA of some maximum length and some PAM sequence of fixed length with or without a degenerate sequence.

How it works: This program works by identifying all potential activity sites for any given guide length/PAM sequence combination during its index operation. During search operations, a given guide sequence will be searched against the indexed sites to determine if any are similar enough to be of concern in designing a CRISPR targeting strategy. During a selection operation, all potential targets for a system are collected from a sequence (or a list of already-selected targets can be supplied) and analyzed. The potential targets will then be sorted by their predicted specificity and efficiency (in that order).

Version history:

Version 1 (All Shiny and Chrome): The original version of this program worked by creating several small files, each containing several thousand potential CRISPR targets from the chosen genome. Sites were stored sequentially, relative to their genomic locus and every site was matched against the site of interest following a highly-parallelized map/reduce type of scheme. This version was forked into a server/stand-alone and cluster version, with one being optimized for use on a single system with multiple cores and the other being optimized for use on a cluster system running an SGE job scheduler. These versions were later rejoined, with cluster or stand-alone mode being specified as an argument.

Version 2 (CRISPR Divided): This version's major change was the introduction of a tree structure to better organize the potential targets. The indexer now separates targets into multiple bins depending upon their sequence immediately prior to the PAM site. This requires significantly more computational effort than the previous method of saving them in the order they are found, and will often result in index jobs requiring double or triple the amount of time required in the previous version. This organization of sites, however, makes site searches significantly more efficient than the previous version. Additionally, this version will not list all potential off-targets during a selection run for potential target sites with with over 100 potential mismatch sites per allowed mismatch (i.e. with the default setting of 3 mismatches, any site with over 300 potential mismatch sites will show how many potential mismatches it has, but will not list them specifically unless clobber mode is set). The changes introduced in this version have resulted in significantly faster searches and selections (with some operations seeing a 30-fold improvement in time) and cleaner outputs.

Version 3 (Orchid Edition): This version has multiple changes for massively scaling-up and running with Microsoft's packages. This version was designed to be called iteratively as one "walks" a chromosome or genome to analyze regions of genomic features. This version also has built-in connectivity to azure data storage resources. This version can now use non-canonical PAM sites (such as NGA and NAG, among others, for pyogenes cas-9). To compensate for the potentially massive increase in data to analyze, the data storage is now in a binary format with site comparisons being handled in a bit-wise manner instead of standard string comparison as before.

Data storage:

The data are now stored using a binary format. For a site with a 3 base PAM sequence, a 20 base guide, and storing up to 4 bases up and downstream, each site can be stored in 20 bytes. The final bytes will always be the guide sequence stored in the 3'-5' orientation in a 2-bit DNA format (A = 00, C = 01, G = 10, T = 11). For site comparison, the site to be compared is converted to a 2-bit format and a binary XOR is carried out between the two sites, with any mismatching bases returning at least one bit true.

About

dsNickFury is for comparing a CRISPR target site against all other potential sites in a genome. Orchid is a package I'm developing to go with it for iterative CRISPR analysis over an exome.

Resources

Stars

Watchers

Forks

Releases

No releases published

Packages

No packages published

Languages