Skip to content

Commit

Permalink
Update for version 0.12
Browse files Browse the repository at this point in the history
  • Loading branch information
iwc-workflows-bot committed Mar 25, 2024
1 parent ce0395d commit e05c5dc
Show file tree
Hide file tree
Showing 4 changed files with 31 additions and 132 deletions.
5 changes: 5 additions & 0 deletions CHANGELOG.md
View file
Original file line number Diff line number Diff line change
@@ -1,5 +1,10 @@
# Changelog

## [0.12] 2024-03-25

### Automatic update
- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.7+galaxy0`

## [0.11] 2024-03-18

### Automatic update
Expand Down
2 changes: 1 addition & 1 deletion atacseq-tests.yml
View file
Original file line number Diff line number Diff line change
Expand Up @@ -106,7 +106,7 @@
cutadapt:
asserts:
has_line:
line: "SRR891268_chr22_enriched_2\t4.6\t285247\t41011\t40415\t4283\t280964\t28524700\t480633\t27163516\t4.771948521807416"
line: "SRR891268_chr22_enriched_2\t4.7\t285247\t41011\t40415\t4283\t280964\t28524700\t480633\t27163516\t4.771948521807416"
general_stats:
asserts:
has_text:
Expand Down
152 changes: 23 additions & 129 deletions atacseq.ga
View file
Original file line number Diff line number Diff line change
Expand Up @@ -10,7 +10,7 @@
],
"format-version": "0.1",
"license": "MIT",
"release": "0.11",
"release": "0.12",
"name": "ATACseq",
"steps": {
"0": {
Expand Down Expand Up @@ -123,7 +123,7 @@
},
"4": {
"annotation": "",
"content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1",
"content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.7+galaxy0",
"errors": null,
"id": 4,
"input_connections": {
Expand Down Expand Up @@ -173,15 +173,15 @@
"output_name": "report"
}
},
"tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1",
"tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.7+galaxy0",
"tool_shed_repository": {
"changeset_revision": "64172f1c1202",
"changeset_revision": "944ae523bacb",
"name": "cutadapt",
"owner": "lparsons",
"tool_shed": "toolshed.g2.bx.psu.edu"
},
"tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"maximum_length\": null, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Nextera R1\", \"adapter\": \"CTGTCTCTTATACACATCTCCGAGCCCACGAGAC\"}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": []}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Nextera R2\", \"adapter\": \"CTGTCTCTTATACACATCTGACGCTGCCGACGA\"}, \"single_noindels\": false}], \"front_adapters2\": [], \"anywhere_adapters2\": [], \"cut2\": \"0\", \"quality_cutoff2\": \"\", \"minimum_length2\": null, \"maximum_length2\": null}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"cut\": \"0\", \"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
"tool_version": "4.6+galaxy1",
"tool_version": "4.7+galaxy0",
"type": "tool",
"uuid": "33fa2759-9f3f-431b-b35c-b5c777d5d5b7",
"when": null,
Expand Down Expand Up @@ -280,12 +280,7 @@
"output_name": "output"
}
},
"inputs": [
{
"description": "runtime parameter for tool Filter BAM",
"name": "input_bam"
}
],
"inputs": [],
"label": "filter MAPQ30 concordant pairs and not mitochondrial pairs",
"name": "Filter BAM",
"outputs": [
Expand Down Expand Up @@ -346,12 +341,7 @@
"output_name": "output"
}
},
"inputs": [
{
"description": "runtime parameter for tool Samtools idxstats",
"name": "input"
}
],
"inputs": [],
"label": "Get number of reads per chromosome",
"name": "Samtools idxstats",
"outputs": [
Expand Down Expand Up @@ -396,12 +386,7 @@
"output_name": "out_file1"
}
},
"inputs": [
{
"description": "runtime parameter for tool MarkDuplicates",
"name": "inputFile"
}
],
"inputs": [],
"label": "remove PCR duplicates",
"name": "MarkDuplicates",
"outputs": [
Expand Down Expand Up @@ -470,12 +455,7 @@
"output_name": "output"
}
},
"inputs": [
{
"description": "runtime parameter for tool Text reformatting",
"name": "infile"
}
],
"inputs": [],
"label": "reads in chrM/MT for multiQC",
"name": "Text reformatting",
"outputs": [
Expand Down Expand Up @@ -520,12 +500,7 @@
"output_name": "outFile"
}
},
"inputs": [
{
"description": "runtime parameter for tool bedtools BAM to BED",
"name": "input"
}
],
"inputs": [],
"label": "convert BAM to BED to improve peak calling",
"name": "bedtools BAM to BED",
"outputs": [
Expand Down Expand Up @@ -577,12 +552,7 @@
"output_name": "outFile"
}
},
"inputs": [
{
"description": "runtime parameter for tool Paired-end histogram",
"name": "input_bam"
}
],
"inputs": [],
"label": "Compute fragment length histogram",
"name": "Paired-end histogram",
"outputs": [
Expand Down Expand Up @@ -644,12 +614,7 @@
"output_name": "outFile"
}
},
"inputs": [
{
"description": "runtime parameter for tool Samtools view",
"name": "input"
}
],
"inputs": [],
"label": "number of reads",
"name": "Samtools view",
"outputs": [
Expand Down Expand Up @@ -833,12 +798,7 @@
"output_name": "outputcnt"
}
},
"inputs": [
{
"description": "runtime parameter for tool Compute",
"name": "input"
}
],
"inputs": [],
"label": "compute 1/million reads",
"name": "Compute",
"outputs": [
Expand Down Expand Up @@ -883,12 +843,7 @@
"output_name": "output_treat_pileup"
}
},
"inputs": [
{
"description": "runtime parameter for tool Wig/BedGraph-to-bigWig",
"name": "input1"
}
],
"inputs": [],
"label": "Bigwig from MACS2 (no norm)",
"name": "Wig/BedGraph-to-bigWig",
"outputs": [
Expand Down Expand Up @@ -943,10 +898,6 @@
{
"description": "runtime parameter for tool bedtools SlopBed",
"name": "genome_file_opts"
},
{
"description": "runtime parameter for tool bedtools SlopBed",
"name": "inputA"
}
],
"label": "get summits +/-500kb",
Expand Down Expand Up @@ -1000,12 +951,7 @@
"output_name": "output_tabular"
}
},
"inputs": [
{
"description": "runtime parameter for tool Search in textfiles",
"name": "infile"
}
],
"inputs": [],
"label": "summary of MACS2",
"name": "Search in textfiles",
"outputs": [
Expand Down Expand Up @@ -1065,12 +1011,7 @@
"output_name": "out_file1"
}
},
"inputs": [
{
"description": "runtime parameter for tool Parse parameter value",
"name": "input1"
}
],
"inputs": [],
"label": "Convert 1/million reads to parameter",
"name": "Parse parameter value",
"outputs": [
Expand Down Expand Up @@ -1109,12 +1050,7 @@
"output_name": "out_file1"
}
},
"inputs": [
{
"description": "runtime parameter for tool Apply rules",
"name": "input"
}
],
"inputs": [],
"label": "Isolate each bigwig do normalize not average",
"name": "Apply rules",
"outputs": [
Expand Down Expand Up @@ -1153,12 +1089,7 @@
"output_name": "output"
}
},
"inputs": [
{
"description": "runtime parameter for tool bedtools MergeBED",
"name": "input"
}
],
"inputs": [],
"label": "Merge summits +/-500kb",
"name": "bedtools MergeBED",
"outputs": [
Expand Down Expand Up @@ -1231,10 +1162,6 @@
{
"description": "runtime parameter for tool bigwigAverage",
"name": "advancedOpt"
},
{
"description": "runtime parameter for tool bigwigAverage",
"name": "bigwigs"
}
],
"label": "normalize by million reads",
Expand Down Expand Up @@ -1294,10 +1221,6 @@
}
},
"inputs": [
{
"description": "runtime parameter for tool bedtools Compute both the depth and breadth of coverage",
"name": "inputA"
},
{
"description": "runtime parameter for tool bedtools Compute both the depth and breadth of coverage",
"name": "reduce_or_iterate"
Expand Down Expand Up @@ -1354,12 +1277,7 @@
"output_name": "output"
}
},
"inputs": [
{
"description": "runtime parameter for tool Text reformatting",
"name": "infile"
}
],
"inputs": [],
"label": "number of reads in peaks",
"name": "Text reformatting",
"outputs": [
Expand Down Expand Up @@ -1419,12 +1337,7 @@
"output_name": "outfile"
}
},
"inputs": [
{
"description": "runtime parameter for tool Compute",
"name": "input"
}
],
"inputs": [],
"label": "compute 1/million reads in peaks",
"name": "Compute",
"outputs": [
Expand Down Expand Up @@ -1473,12 +1386,7 @@
"output_name": "outputcnt"
}
},
"inputs": [
{
"description": "runtime parameter for tool Concatenate datasets",
"name": "input1"
}
],
"inputs": [],
"label": "Combine number of reads in peaks with total number of reads",
"name": "Concatenate datasets",
"outputs": [
Expand Down Expand Up @@ -1517,12 +1425,7 @@
"output_name": "out_file1"
}
},
"inputs": [
{
"description": "runtime parameter for tool Parse parameter value",
"name": "input1"
}
],
"inputs": [],
"label": "Convert 1/million reads in peaks to parameter",
"name": "Parse parameter value",
"outputs": [
Expand Down Expand Up @@ -1561,12 +1464,7 @@
"output_name": "out_file1"
}
},
"inputs": [
{
"description": "runtime parameter for tool Text reformatting",
"name": "infile"
}
],
"inputs": [],
"label": "reads in peaks multiQC",
"name": "Text reformatting",
"outputs": [
Expand Down Expand Up @@ -1631,10 +1529,6 @@
{
"description": "runtime parameter for tool bigwigAverage",
"name": "advancedOpt"
},
{
"description": "runtime parameter for tool bigwigAverage",
"name": "bigwigs"
}
],
"label": "normalize by million reads in peaks",
Expand Down
4 changes: 2 additions & 2 deletions ro-crate-metadata.json
View file
Original file line number Diff line number Diff line change
Expand Up @@ -21,7 +21,7 @@
{
"@id": "./",
"@type": "Dataset",
"datePublished": "2024-03-19T08:15:08.617178",
"datePublished": "2024-03-25T09:46:47.919660",
"hasPart": [
{
"@id": "atacseq.ga"
Expand Down Expand Up @@ -72,7 +72,7 @@
"@id": "#galaxy"
},
"url": "https://github.com/iwc-workflows/atacseq",
"version": "0.11"
"version": "0.12"
},
{
"@id": "#galaxy",
Expand Down

0 comments on commit e05c5dc

Please sign in to comment.