Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Prevent repeated processing of files/contributors.tsv #1285

Merged
merged 7 commits into from
Jan 12, 2024
Merged

Prevent repeated processing of files/contributors.tsv #1285

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
7 commits
Select commit Hold shift + click to select a range
b133664
refactored plugin and contributors/antibodies checking logic in uploa…
gesinaphillips Jan 9, 2024
3fbe1fe
ran online tests, updated outputs accordingly; all mocked responses u…
gesinaphillips Jan 9, 2024
22d079e
adding plugin test, currently the diff is broken
gesinaphillips Jan 9, 2024
c493fda
merging changes from main
gesinaphillips Jan 11, 2024
00d89db
added basic plugin test
gesinaphillips Jan 11, 2024
156f344
added codex test, accounted for canonical assaytype strings
gesinaphillips Jan 11, 2024
d3d71bf
cleanup
gesinaphillips Jan 12, 2024
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
1 change: 1 addition & 0 deletions CHANGELOG.md
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -9,6 +9,7 @@
- Add GeoMx NGS next-gen directory schema
- Update PhenoCycler and Histology to 2.2.0
- Update CEDAR links for PhenoCycler & Histology
- Refactor Upload to avoid validating the same contributors.tsv multiple times / running plugins over files multiple times

## v0.0.16

Expand Down
2 changes: 1 addition & 1 deletion examples/dataset-examples/bad-cedar-assay-histology/MOCK_RESPONSE.json
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1 +1 @@
{"Histology": {"args": ["wrong", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "DNA", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./dataset-1", "Yes", "H&E", "Progressive staining", "Yes", "No", "HTX Technologies", "SunCollect Sprayer", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "30", "e7475329-9a60-4088-8e34-19a3828e0b3b"], "response": {"assaytype": "h-and-e", "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "vitessce-hints": []}}}
{"Histology": {"args": ["wrong", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "DNA", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./dataset-1", "Yes", "H&E", "Progressive staining", "Yes", "No", "HTX Technologies", "SunCollect Sprayer", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "30", "e7475329-9a60-4088-8e34-19a3828e0b3b"], "response": {"assaytype": "h-and-e", "contains-pii": false, "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}}
5 changes: 3 additions & 2 deletions examples/dataset-examples/bad-cedar-assay-histology/README_ONLINE.md
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,8 +1,9 @@
```
Upload Errors:
TSV Errors:
examples/dataset-examples/bad-cedar-assay-histology/upload/bad-histology-metadata.tsv row 2, column 'contributors_path':
CEDAR Validation Errors:
? examples/dataset-examples/bad-cedar-assay-histology/upload/bad-histology-metadata.tsv,
column 'contributors_path', value './contributors.tsv'
: CEDAR Validation Errors:
examples/dataset-examples/bad-cedar-assay-histology/upload/contributors.tsv:
Validation Errors:
- On row 0, column "orcid", value "0000-0002-8928-abcd" fails because of
Expand Down
2 changes: 1 addition & 1 deletion examples/dataset-examples/bad-cedar-dir-histology/MOCK_RESPONSE.json
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1 +1 @@
{"Histology": {"args": ["HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "DNA", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./dataset-1", "Yes", "H&E", "Progressive staining", "Yes", "No", "HTX Technologies", "SunCollect Sprayer", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "30", "e7475329-9a60-4088-8e34-19a3828e0b3b"], "response": {"assaytype": "h-and-e", "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "vitessce-hints": []}}}
{"Histology": {"args": ["HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "DNA", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./dataset-1", "Yes", "H&E", "Progressive staining", "Yes", "No", "HTX Technologies", "SunCollect Sprayer", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "30", "e7475329-9a60-4088-8e34-19a3828e0b3b"], "response": {"assaytype": "h-and-e", "contains-pii": false, "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}}
7 changes: 4 additions & 3 deletions examples/dataset-examples/bad-cedar-dir-histology/README.md
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,10 +1,11 @@
```
Upload Errors:
Directory Errors:
examples/dataset-examples/bad-cedar-dir-histology/upload/bad-histology-metadata.tsv, row 2, column data_path:
examples/dataset-examples/bad-cedar-dir-histology/upload/dataset-1 (as histology-v2):
? examples/dataset-examples/bad-cedar-dir-histology/upload/bad-histology-metadata.tsv,
column 'data_path', value './dataset-1'
: examples/dataset-examples/bad-cedar-dir-histology/upload/dataset-1 (as histology-v2):
No such file or directory: examples/dataset-examples/bad-cedar-dir-histology/upload/dataset-1
examples/dataset-examples/bad-cedar-dir-histology/upload/bad-histology-metadata.tsv, row 3, column data_path:
examples/dataset-examples/bad-cedar-dir-histology/upload/bad-histology-metadata.tsv, column 'data_path', value './wrong':
examples/dataset-examples/bad-cedar-dir-histology/upload/wrong (as histology-v2):
Not allowed:
- not-allowed.
Expand Down
7 changes: 4 additions & 3 deletions examples/dataset-examples/bad-cedar-dir-histology/README_ONLINE.md
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,10 +1,11 @@
```
Upload Errors:
Directory Errors:
examples/dataset-examples/bad-cedar-dir-histology/upload/bad-histology-metadata.tsv, row 2, column data_path:
examples/dataset-examples/bad-cedar-dir-histology/upload/dataset-1 (as histology-v2):
? examples/dataset-examples/bad-cedar-dir-histology/upload/bad-histology-metadata.tsv,
column 'data_path', value './dataset-1'
: examples/dataset-examples/bad-cedar-dir-histology/upload/dataset-1 (as histology-v2):
No such file or directory: examples/dataset-examples/bad-cedar-dir-histology/upload/dataset-1
examples/dataset-examples/bad-cedar-dir-histology/upload/bad-histology-metadata.tsv, row 3, column data_path:
examples/dataset-examples/bad-cedar-dir-histology/upload/bad-histology-metadata.tsv, column 'data_path', value './wrong':
examples/dataset-examples/bad-cedar-dir-histology/upload/wrong (as histology-v2):
Not allowed:
- not-allowed.
Expand Down
2 changes: 1 addition & 1 deletion examples/dataset-examples/bad-cedar-multi-assay-visium-bad-child-metadata/MOCK_RESPONSE.json
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1 +1 @@
{"Visium (no probes)": {"args": ["babf1e69-f0eb-479a-bdc5-b70199669675", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Visium (no probes)", "./contributors.tsv", "./Visium_9OLC_A4_S1", "42.25", "mm^2", "2375.9", "um^2", "4992", "100", "um", "A1", "24", "minute"], "response": {"assaytype": "visium-no-probes", "description": "Visium (No probes)", "dir-schema": "visium-no-probes-v2", "must-contain": ["Histology", "RNAseq"], "vitessce-hints": []}}, "Histology": {"args": ["e7475329-9a60-4088-8e34-19a3828e0b3b", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "nucleic acid and protein", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "Yes", "H&E", "progressive staining", "Yes", "No", "Not applicable", "Not applicable", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "0.3"], "response": {"assaytype": "h-and-e", "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "vitessce-hints": []}}, "RNAseq": {"args": ["944e5fa0-f68b-4bdd-8664-74a3909429a9", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "RNAseq", "RNA", "No", "Illumina", "NovaSeq 6000", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "0", "Read 1 (R1)", "16", "16", "Read 1 (R1)", "12", "spot", "", "", "", "TSO: AAGCAGTGGTATCAACGCAGAGTACATGGG", "517", "176.834", "ng", "735.479", "ng", "61.584", "nM", "single-end", "16", "16", "10X Genomics; Visium Spatial Gene Expression Slide and Reagent Kit, 4 slides, 16 reactions; PN 1000184", "10X Genomics; Dual Index Kit TT, Set A (96 rxn); PN 1000215", "SI-TT-D1", "No", "1448", "Illumina; NovaSeq 6000 S1 Reagent v1.5 Kit (100 Cycles); PN 20028319", "28,10,10,90", "Penn-E.768", "", "", "", ""], "response": {"assaytype": "scRNAseq-10Genomics-v3", "description": "scRNA-seq (10x Genomics v3)", "dir-schema": "scrnaseq-v2", "vitessce-hints": []}}}
{"Visium (no probes)": {"args": ["babf1e69-f0eb-479a-bdc5-b70199669675", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Visium (no probes)", "./contributors.tsv", "./Visium_9OLC_A4_S1", "42.25", "mm^2", "2375.9", "um^2", "4992", "100", "um", "A1", "24", "minute"], "response": {"assaytype": "visium-no-probes", "contains-pii": true, "description": "Visium (No probes)", "dir-schema": "visium-no-probes-v2", "must-contain": ["Histology", "RNAseq"], "primary": true, "vitessce-hints": []}}, "Histology": {"args": ["e7475329-9a60-4088-8e34-19a3828e0b3b", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "nucleic acid and protein", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "Yes", "H&E", "progressive staining", "Yes", "No", "Not applicable", "Not applicable", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "0.3"], "response": {"assaytype": "h-and-e", "contains-pii": false, "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}, "RNAseq": {"args": ["944e5fa0-f68b-4bdd-8664-74a3909429a9", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "RNAseq", "RNA", "No", "Illumina", "NovaSeq 6000", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "0", "Read 1 (R1)", "16", "16", "Read 1 (R1)", "12", "spot", "", "", "", "TSO: AAGCAGTGGTATCAACGCAGAGTACATGGG", "517", "176.834", "ng", "735.479", "ng", "61.584", "nM", "single-end", "16", "16", "10X Genomics; Visium Spatial Gene Expression Slide and Reagent Kit, 4 slides, 16 reactions; PN 1000184", "10X Genomics; Dual Index Kit TT, Set A (96 rxn); PN 1000215", "SI-TT-D1", "No", "1448", "Illumina; NovaSeq 6000 S1 Reagent v1.5 Kit (100 Cycles); PN 20028319", "28,10,10,90", "Penn-E.768", "", "", "", ""], "response": {"assaytype": "scRNAseq-10Genomics-v3", "contains-pii": true, "description": "scRNA-seq (10x Genomics v3)", "dir-schema": "rnaseq-v2", "primary": true, "vitessce-hints": []}}}
2 changes: 1 addition & 1 deletion examples/dataset-examples/bad-cedar-multi-assay-visium-bad-dir-structure/MOCK_RESPONSE.json
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1 +1 @@
{"Visium (no probes)": {"args": ["babf1e69-f0eb-479a-bdc5-b70199669675", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Visium (no probes)", "./contributors.tsv", "./Visium_9OLC_A4_S1", "42.25", "mm^2", "2375.9", "um^2", "4992", "100", "um", "A1", "24", "minute"], "response": {"assaytype": "visium-no-probes", "description": "Visium (No probes)", "dir-schema": "visium-no-probes-v2", "must-contain": ["Histology", "RNAseq"], "vitessce-hints": []}}, "Histology": {"args": ["e7475329-9a60-4088-8e34-19a3828e0b3b", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "nucleic acid and protein", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "Yes", "H&E", "progressive staining", "Yes", "No", "Not applicable", "Not applicable", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "0.3"], "response": {"assaytype": "h-and-e", "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "vitessce-hints": []}}, "RNAseq": {"args": ["944e5fa0-f68b-4bdd-8664-74a3909429a9", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "RNAseq", "RNA", "No", "Illumina", "NovaSeq 6000", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "0", "Read 1 (R1)", "16", "16", "Read 1 (R1)", "12", "spot", "", "", "", "TSO: AAGCAGTGGTATCAACGCAGAGTACATGGG", "517", "176.834", "ng", "735.479", "ng", "61.584", "nM", "single-end", "16", "16", "10X Genomics; Visium Spatial Gene Expression Slide and Reagent Kit, 4 slides, 16 reactions; PN 1000184", "10X Genomics; Dual Index Kit TT, Set A (96 rxn); PN 1000215", "SI-TT-D1", "No", "1448", "Illumina; NovaSeq 6000 S1 Reagent v1.5 Kit (100 Cycles); PN 20028319", "28,10,10,90", "Penn-E.768", "", "", "", ""], "response": {"assaytype": "scRNAseq-10Genomics-v3", "description": "scRNA-seq (10x Genomics v3)", "dir-schema": "scrnaseq-v2", "vitessce-hints": []}}}
{"Visium (no probes)": {"args": ["babf1e69-f0eb-479a-bdc5-b70199669675", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Visium (no probes)", "./contributors.tsv", "./Visium_9OLC_A4_S1", "42.25", "mm^2", "2375.9", "um^2", "4992", "100", "um", "A1", "24", "minute"], "response": {"assaytype": "visium-no-probes", "contains-pii": true, "description": "Visium (No probes)", "dir-schema": "visium-no-probes-v2", "must-contain": ["Histology", "RNAseq"], "primary": true, "vitessce-hints": []}}, "Histology": {"args": ["e7475329-9a60-4088-8e34-19a3828e0b3b", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "nucleic acid and protein", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "Yes", "H&E", "progressive staining", "Yes", "No", "Not applicable", "Not applicable", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "0.3"], "response": {"assaytype": "h-and-e", "contains-pii": false, "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}, "RNAseq": {"args": ["944e5fa0-f68b-4bdd-8664-74a3909429a9", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "RNAseq", "RNA", "No", "Illumina", "NovaSeq 6000", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "0", "Read 1 (R1)", "16", "16", "Read 1 (R1)", "12", "spot", "", "", "", "TSO: AAGCAGTGGTATCAACGCAGAGTACATGGG", "517", "176.834", "ng", "735.479", "ng", "61.584", "nM", "single-end", "16", "16", "10X Genomics; Visium Spatial Gene Expression Slide and Reagent Kit, 4 slides, 16 reactions; PN 1000184", "10X Genomics; Dual Index Kit TT, Set A (96 rxn); PN 1000215", "SI-TT-D1", "No", "1448", "Illumina; NovaSeq 6000 S1 Reagent v1.5 Kit (100 Cycles); PN 20028319", "28,10,10,90", "Penn-E.768", "", "", "", ""], "response": {"assaytype": "scRNAseq-10Genomics-v3", "contains-pii": true, "description": "scRNA-seq (10x Genomics v3)", "dir-schema": "rnaseq-v2", "primary": true, "vitessce-hints": []}}}
2 changes: 1 addition & 1 deletion examples/dataset-examples/bad-cedar-multi-assay-visium-missing-child/MOCK_RESPONSE.json
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1 +1 @@
{"Visium (no probes)": {"args": ["babf1e69-f0eb-479a-bdc5-b70199669675", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Visium (no probes)", "./contributors.tsv", "./Visium_9OLC_A4_S1", "42.25", "mm^2", "2375.9", "um^2", "4992", "100", "um", "A1", "24", "minute"], "response": {"assaytype": "visium-no-probes", "description": "Visium (No probes)", "dir-schema": "visium-no-probes-v2", "must-contain": ["Histology", "RNAseq"], "vitessce-hints": []}}, "Histology": {"args": ["e7475329-9a60-4088-8e34-19a3828e0b3b", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "nucleic acid and protein", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "Yes", "H&E", "progressive staining", "Yes", "No", "Not applicable", "Not applicable", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "0.3"], "response": {"assaytype": "h-and-e", "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "vitessce-hints": []}}, "RNAseq": {"args": ["944e5fa0-f68b-4bdd-8664-74a3909429a9", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "RNAseq", "RNA", "No", "Illumina", "NovaSeq 6000", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "0", "Read 1 (R1)", "16", "16", "Read 1 (R1)", "12", "spot", "", "", "", "TSO: AAGCAGTGGTATCAACGCAGAGTACATGGG", "517", "176.834", "ng", "735.479", "ng", "61.584", "nM", "single-end", "16", "16", "10X Genomics; Visium Spatial Gene Expression Slide and Reagent Kit, 4 slides, 16 reactions; PN 1000184", "10X Genomics; Dual Index Kit TT, Set A (96 rxn); PN 1000215", "SI-TT-D1", "No", "1448", "Illumina; NovaSeq 6000 S1 Reagent v1.5 Kit (100 Cycles); PN 20028319", "28,10,10,90", "Penn-E.768", "", "", "", ""], "response": {"assaytype": "snRNAseq-10xGenomics-v3", "description": "snRNA-seq (10x Genomics v3)", "dir-schema": "scrnaseq-v2", "vitessce-hints": []}}}
{"Visium (no probes)": {"args": ["babf1e69-f0eb-479a-bdc5-b70199669675", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Visium (no probes)", "./contributors.tsv", "./Visium_9OLC_A4_S1", "42.25", "mm^2", "2375.9", "um^2", "4992", "100", "um", "A1", "24", "minute"], "response": {"assaytype": "visium-no-probes", "contains-pii": true, "description": "Visium (No probes)", "dir-schema": "visium-no-probes-v2", "must-contain": ["Histology", "RNAseq"], "primary": true, "vitessce-hints": []}}, "Histology": {"args": ["e7475329-9a60-4088-8e34-19a3828e0b3b", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "nucleic acid and protein", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "Yes", "H&E", "progressive staining", "Yes", "No", "Not applicable", "Not applicable", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "0.3"], "response": {"assaytype": "h-and-e", "contains-pii": false, "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}, "RNAseq": {"args": ["944e5fa0-f68b-4bdd-8664-74a3909429a9", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "RNAseq", "RNA", "No", "Illumina", "NovaSeq 6000", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "0", "Read 1 (R1)", "16", "16", "Read 1 (R1)", "12", "spot", "", "", "", "TSO: AAGCAGTGGTATCAACGCAGAGTACATGGG", "517", "176.834", "ng", "735.479", "ng", "61.584", "nM", "single-end", "16", "16", "10X Genomics; Visium Spatial Gene Expression Slide and Reagent Kit, 4 slides, 16 reactions; PN 1000184", "10X Genomics; Dual Index Kit TT, Set A (96 rxn); PN 1000215", "SI-TT-D1", "No", "1448", "Illumina; NovaSeq 6000 S1 Reagent v1.5 Kit (100 Cycles); PN 20028319", "28,10,10,90", "Penn-E.768", "", "", "", ""], "response": {"assaytype": "snRNAseq-10xGenomics-v3", "description": "snRNA-seq (10x Genomics v3)", "dir-schema": "scrnaseq-v2", "vitessce-hints": []}}}
Loading
Loading