-
Notifications
You must be signed in to change notification settings - Fork 18
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Prevent multiple dataset types in a single non-multi-assay upload (#1298
- Loading branch information
1 parent
989031a
commit fb86d94
Showing
37 changed files
with
52 additions
and
146 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
2 changes: 1 addition & 1 deletion
2
examples/dataset-examples/bad-cedar-assay-histology/MOCK_RESPONSE.json
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -1 +1 @@ | ||
| {"Histology": {"args": ["wrong", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "DNA", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./dataset-1", "Yes", "H&E", "Progressive staining", "Yes", "No", "HTX Technologies", "SunCollect Sprayer", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "30", "e7475329-9a60-4088-8e34-19a3828e0b3b"], "response": {"assaytype": "h-and-e", "contains-pii": false, "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}} | ||
| {"Histology": {"args": ["wrong", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "DNA", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./dataset-1", "Yes", "H&E", "Progressive staining", "Yes", "No", "HTX Technologies", "SunCollect Sprayer", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "30", "e7475329-9a60-4088-8e34-19a3828e0b3b"], "response": {"assaytype": "h-and-e", "contains-pii": false, "dataset-type": "Histology", "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}} |
2 changes: 1 addition & 1 deletion
2
examples/dataset-examples/bad-cedar-dir-histology/MOCK_RESPONSE.json
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -1 +1 @@ | ||
| {"Histology": {"args": ["HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "DNA", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./dataset-1", "Yes", "H&E", "Progressive staining", "Yes", "No", "HTX Technologies", "SunCollect Sprayer", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "30", "e7475329-9a60-4088-8e34-19a3828e0b3b"], "response": {"assaytype": "h-and-e", "contains-pii": false, "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}} | ||
| {"Histology": {"args": ["HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "DNA", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./dataset-1", "Yes", "H&E", "Progressive staining", "Yes", "No", "HTX Technologies", "SunCollect Sprayer", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "30", "e7475329-9a60-4088-8e34-19a3828e0b3b"], "response": {"assaytype": "h-and-e", "contains-pii": false, "dataset-type": "Histology", "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}} |
2 changes: 1 addition & 1 deletion
2
examples/dataset-examples/bad-cedar-multi-assay-visium-bad-child-metadata/MOCK_RESPONSE.json
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -1 +1 @@ | ||
| {"Visium (no probes)": {"args": ["babf1e69-f0eb-479a-bdc5-b70199669675", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Visium (no probes)", "./contributors.tsv", "./Visium_9OLC_A4_S1", "42.25", "mm^2", "2375.9", "um^2", "4992", "100", "um", "A1", "24", "minute"], "response": {"assaytype": "visium-no-probes", "contains-pii": true, "description": "Visium (No probes)", "dir-schema": "visium-no-probes-v2", "must-contain": ["Histology", "RNAseq"], "primary": true, "vitessce-hints": []}}, "Histology": {"args": ["e7475329-9a60-4088-8e34-19a3828e0b3b", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "nucleic acid and protein", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "Yes", "H&E", "progressive staining", "Yes", "No", "Not applicable", "Not applicable", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "0.3"], "response": {"assaytype": "h-and-e", "contains-pii": false, "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}, "RNAseq": {"args": ["944e5fa0-f68b-4bdd-8664-74a3909429a9", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "RNAseq", "RNA", "No", "Illumina", "NovaSeq 6000", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "0", "Read 1 (R1)", "16", "16", "Read 1 (R1)", "12", "spot", "", "", "", "TSO: AAGCAGTGGTATCAACGCAGAGTACATGGG", "517", "176.834", "ng", "735.479", "ng", "61.584", "nM", "single-end", "16", "16", "10X Genomics; Visium Spatial Gene Expression Slide and Reagent Kit, 4 slides, 16 reactions; PN 1000184", "10X Genomics; Dual Index Kit TT, Set A (96 rxn); PN 1000215", "SI-TT-D1", "No", "1448", "Illumina; NovaSeq 6000 S1 Reagent v1.5 Kit (100 Cycles); PN 20028319", "28,10,10,90", "Penn-E.768", "", "", "", ""], "response": {"assaytype": "scRNAseq-10Genomics-v3", "contains-pii": true, "description": "scRNA-seq (10x Genomics v3)", "dir-schema": "rnaseq-v2", "primary": true, "vitessce-hints": []}}} | ||
| {"Visium (no probes)": {"args": ["babf1e69-f0eb-479a-bdc5-b70199669675", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Visium (no probes)", "./contributors.tsv", "./Visium_9OLC_A4_S1", "42.25", "mm^2", "2375.9", "um^2", "4992", "100", "um", "A1", "24", "minute"], "response": {"assaytype": "visium-no-probes", "contains-pii": true, "dataset-type": "Visium (no probes)", "description": "Visium (No probes)", "dir-schema": "visium-no-probes-v2", "must-contain": ["Histology", "RNAseq"], "primary": true, "vitessce-hints": []}}, "Histology": {"args": ["e7475329-9a60-4088-8e34-19a3828e0b3b", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "nucleic acid and protein", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "Yes", "H&E", "progressive staining", "Yes", "No", "Not applicable", "Not applicable", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "0.3"], "response": {"assaytype": "h-and-e", "contains-pii": false, "dataset-type": "Histology", "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}, "RNAseq": {"args": ["944e5fa0-f68b-4bdd-8664-74a3909429a9", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "RNAseq", "RNA", "No", "Illumina", "NovaSeq 6000", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "0", "Read 1 (R1)", "16", "16", "Read 1 (R1)", "12", "spot", "", "", "", "TSO: AAGCAGTGGTATCAACGCAGAGTACATGGG", "517", "176.834", "ng", "735.479", "ng", "61.584", "nM", "single-end", "16", "16", "10X Genomics; Visium Spatial Gene Expression Slide and Reagent Kit, 4 slides, 16 reactions; PN 1000184", "10X Genomics; Dual Index Kit TT, Set A (96 rxn); PN 1000215", "SI-TT-D1", "No", "1448", "Illumina; NovaSeq 6000 S1 Reagent v1.5 Kit (100 Cycles); PN 20028319", "28,10,10,90", "Penn-E.768", "", "", "", ""], "response": {"assaytype": "scRNAseq-10Genomics-v3", "contains-pii": true, "dataset-type": "RNAseq", "description": "scRNA-seq (10x Genomics v3)", "dir-schema": "rnaseq-v2", "primary": true, "vitessce-hints": []}}} |
2 changes: 1 addition & 1 deletion
2
examples/dataset-examples/bad-cedar-multi-assay-visium-bad-dir-structure/MOCK_RESPONSE.json
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -1 +1 @@ | ||
| {"Visium (no probes)": {"args": ["babf1e69-f0eb-479a-bdc5-b70199669675", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Visium (no probes)", "./contributors.tsv", "./Visium_9OLC_A4_S1", "42.25", "mm^2", "2375.9", "um^2", "4992", "100", "um", "A1", "24", "minute"], "response": {"assaytype": "visium-no-probes", "contains-pii": true, "description": "Visium (No probes)", "dir-schema": "visium-no-probes-v2", "must-contain": ["Histology", "RNAseq"], "primary": true, "vitessce-hints": []}}, "Histology": {"args": ["e7475329-9a60-4088-8e34-19a3828e0b3b", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "nucleic acid and protein", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "Yes", "H&E", "progressive staining", "Yes", "No", "Not applicable", "Not applicable", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "0.3"], "response": {"assaytype": "h-and-e", "contains-pii": false, "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}, "RNAseq": {"args": ["944e5fa0-f68b-4bdd-8664-74a3909429a9", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "RNAseq", "RNA", "No", "Illumina", "NovaSeq 6000", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "0", "Read 1 (R1)", "16", "16", "Read 1 (R1)", "12", "spot", "", "", "", "TSO: AAGCAGTGGTATCAACGCAGAGTACATGGG", "517", "176.834", "ng", "735.479", "ng", "61.584", "nM", "single-end", "16", "16", "10X Genomics; Visium Spatial Gene Expression Slide and Reagent Kit, 4 slides, 16 reactions; PN 1000184", "10X Genomics; Dual Index Kit TT, Set A (96 rxn); PN 1000215", "SI-TT-D1", "No", "1448", "Illumina; NovaSeq 6000 S1 Reagent v1.5 Kit (100 Cycles); PN 20028319", "28,10,10,90", "Penn-E.768", "", "", "", ""], "response": {"assaytype": "scRNAseq-10Genomics-v3", "contains-pii": true, "description": "scRNA-seq (10x Genomics v3)", "dir-schema": "rnaseq-v2", "primary": true, "vitessce-hints": []}}} | ||
| {"Visium (no probes)": {"args": ["babf1e69-f0eb-479a-bdc5-b70199669675", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Visium (no probes)", "./contributors.tsv", "./Visium_9OLC_A4_S1", "42.25", "mm^2", "2375.9", "um^2", "4992", "100", "um", "A1", "24", "minute"], "response": {"assaytype": "visium-no-probes", "contains-pii": true, "dataset-type": "Visium (no probes)", "description": "Visium (No probes)", "dir-schema": "visium-no-probes-v2", "must-contain": ["Histology", "RNAseq"], "primary": true, "vitessce-hints": []}}, "Histology": {"args": ["e7475329-9a60-4088-8e34-19a3828e0b3b", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "nucleic acid and protein", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "Yes", "H&E", "progressive staining", "Yes", "No", "Not applicable", "Not applicable", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "0.3"], "response": {"assaytype": "h-and-e", "contains-pii": false, "dataset-type": "Histology", "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}, "RNAseq": {"args": ["944e5fa0-f68b-4bdd-8664-74a3909429a9", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "RNAseq", "RNA", "No", "Illumina", "NovaSeq 6000", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "0", "Read 1 (R1)", "16", "16", "Read 1 (R1)", "12", "spot", "", "", "", "TSO: AAGCAGTGGTATCAACGCAGAGTACATGGG", "517", "176.834", "ng", "735.479", "ng", "61.584", "nM", "single-end", "16", "16", "10X Genomics; Visium Spatial Gene Expression Slide and Reagent Kit, 4 slides, 16 reactions; PN 1000184", "10X Genomics; Dual Index Kit TT, Set A (96 rxn); PN 1000215", "SI-TT-D1", "No", "1448", "Illumina; NovaSeq 6000 S1 Reagent v1.5 Kit (100 Cycles); PN 20028319", "28,10,10,90", "Penn-E.768", "", "", "", ""], "response": {"assaytype": "scRNAseq-10Genomics-v3", "contains-pii": true, "dataset-type": "RNAseq", "description": "scRNA-seq (10x Genomics v3)", "dir-schema": "rnaseq-v2", "primary": true, "vitessce-hints": []}}} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
2 changes: 1 addition & 1 deletion
2
examples/dataset-examples/bad-cedar-multi-assay-visium-missing-child/MOCK_RESPONSE.json
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -1 +1 @@ | ||
| {"Visium (no probes)": {"args": ["babf1e69-f0eb-479a-bdc5-b70199669675", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Visium (no probes)", "./contributors.tsv", "./Visium_9OLC_A4_S1", "42.25", "mm^2", "2375.9", "um^2", "4992", "100", "um", "A1", "24", "minute"], "response": {"assaytype": "visium-no-probes", "contains-pii": true, "description": "Visium (No probes)", "dir-schema": "visium-no-probes-v2", "must-contain": ["Histology", "RNAseq"], "primary": true, "vitessce-hints": []}}, "Histology": {"args": ["e7475329-9a60-4088-8e34-19a3828e0b3b", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "nucleic acid and protein", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "Yes", "H&E", "progressive staining", "Yes", "No", "Not applicable", "Not applicable", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "0.3"], "response": {"assaytype": "h-and-e", "contains-pii": false, "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}, "RNAseq": {"args": ["944e5fa0-f68b-4bdd-8664-74a3909429a9", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "RNAseq", "RNA", "No", "Illumina", "NovaSeq 6000", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "0", "Read 1 (R1)", "16", "16", "Read 1 (R1)", "12", "spot", "", "", "", "TSO: AAGCAGTGGTATCAACGCAGAGTACATGGG", "517", "176.834", "ng", "735.479", "ng", "61.584", "nM", "single-end", "16", "16", "10X Genomics; Visium Spatial Gene Expression Slide and Reagent Kit, 4 slides, 16 reactions; PN 1000184", "10X Genomics; Dual Index Kit TT, Set A (96 rxn); PN 1000215", "SI-TT-D1", "No", "1448", "Illumina; NovaSeq 6000 S1 Reagent v1.5 Kit (100 Cycles); PN 20028319", "28,10,10,90", "Penn-E.768", "", "", "", ""], "response": {"assaytype": "snRNAseq-10xGenomics-v3", "description": "snRNA-seq (10x Genomics v3)", "dir-schema": "scrnaseq-v2", "vitessce-hints": []}}} | ||
| {"Visium (no probes)": {"args": ["babf1e69-f0eb-479a-bdc5-b70199669675", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Visium (no probes)", "./contributors.tsv", "./Visium_9OLC_A4_S1", "42.25", "mm^2", "2375.9", "um^2", "4992", "100", "um", "A1", "24", "minute"], "response": {"assaytype": "visium-no-probes", "contains-pii": true, "dataset-type": "Visium (no probes)", "description": "Visium (No probes)", "dir-schema": "visium-no-probes-v2", "must-contain": ["Histology", "RNAseq"], "primary": true, "vitessce-hints": []}}, "Histology": {"args": ["e7475329-9a60-4088-8e34-19a3828e0b3b", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "Histology", "nucleic acid and protein", "No", "Zeiss Microscopy", "Axio Observer 7", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "Yes", "H&E", "progressive staining", "Yes", "No", "Not applicable", "Not applicable", "V11A19-078", "Snake-by-rows", "Right-and-down", "10", "120", "0.3"], "response": {"assaytype": "h-and-e", "contains-pii": false, "dataset-type": "Histology", "description": "H&E Stained Microscopy", "dir-schema": "histology-v2", "primary": true, "vitessce-hints": []}}, "RNAseq": {"args": ["944e5fa0-f68b-4bdd-8664-74a3909429a9", "HBM233.CGGG.482", "Visium_9OLC_A4_S1", "https://dx.doi.org/10.17504/protocols.io.eq2lyno9qvx9/v1", "RNAseq", "RNA", "No", "Illumina", "NovaSeq 6000", "24", "day", "", "", "./contributors.tsv", "./Visium_9OLC_A4_S1", "0", "Read 1 (R1)", "16", "16", "Read 1 (R1)", "12", "spot", "", "", "", "TSO: AAGCAGTGGTATCAACGCAGAGTACATGGG", "517", "176.834", "ng", "735.479", "ng", "61.584", "nM", "single-end", "16", "16", "10X Genomics; Visium Spatial Gene Expression Slide and Reagent Kit, 4 slides, 16 reactions; PN 1000184", "10X Genomics; Dual Index Kit TT, Set A (96 rxn); PN 1000215", "SI-TT-D1", "No", "1448", "Illumina; NovaSeq 6000 S1 Reagent v1.5 Kit (100 Cycles); PN 20028319", "28,10,10,90", "Penn-E.768", "", "", "", ""], "response": {"assaytype": "snRNAseq-10xGenomics-v3", "description": "snRNA-seq (10x Genomics v3)", "dir-schema": "scrnaseq-v2", "vitessce-hints": []}}} |
Oops, something went wrong.