RaSE is a python (2.7) program that uses the graph vectorization technique of EDeN to compute a score indicative of the structural stability responsibility of each nucleotide in an RNA sequence. The score is computed as the similarity of the structure obtained by changing a single nucleotide with respect to the original structure. Out of the 3 possible alternatives, only the one which yields the largest difference is reported. The problem of assessing the similarity between two structures is cast in the equivalent problem of assessing the similarity between two graphs that encode the structural information. Structure information is assessed using the RNAplfold program, which provides probability information for all possible base pairs between nucleotides. The graph embedding represents nucleotides as nodes labeled with the one letter code (A|C|G|U
); relations representing backbone bonds and base pairs with a probability higher than --hard_threshold
are repersented as conjunctive edges, relations between base pairs with probability in the interval --avg_bp_prob_cutoff
and --hard_threshold
are represented as disjunctive edges. Graphs are transformed into a high dimensional sparse vector representation using the graph vectorization technique of EDeN. The similarity between the corresponding vectors is then computed as the cosine similarity.
You can use the conda package manager to install RaSE.
conda install -c bioconda rase
RaSe takes in input a RNA sequence as a single string of one letter code (A|C|G|U
). The string can be provided via stdin or via the -i
flag.
RaSe outputs to stdout a space separated tabular file with the following format: the first line contains the Minimum Free Energy structure (MFE) in dotbracket notation of the original sequence; the following lines contain the nucleotide (nt) position, the nt one letter code (A|C|G|U
), the nt code for the mutation that most changes the computed structure, the similarity score between the original structure and the structure obtained by the mutation, the MFE structure of the mutated sequence in dotbracket notation and an optional character *
marking the top dissimilar cases.
(((((((((((.((.......)).))))..............((((((...))))))(((((.......)))))))))))).
0 G C 0.63 ((((.((((((.((.......)).)))))).)))).......((((((...))))))(((((.......)))))........
1 C G 0.23 (((((((.((((((((.........((((((.......))))))..))))))))...(((((.......)))))))))))). *
RaSE can optionally produce image files in various formats (jpg, png, svg, pdf). When invoked with the flag --draw
the following files are produced: structure.[format]
, plot.[format]
, structures.[format]
The structure
image depicts the graph encoding of the most probable RNA structure: edges representing the backbone or base pairs with a probability higher than --hard_threshold
are displayed with a solid line, edges between base pairs with probability in the interval --avg_bp_prob_cutoff
and --hard_threshold
are displayed with a dashed line. The node label is composed of the original nt (above) and the mutation that most changes the computed structure (below). The color intensity is proportional to 1 - similarity, so that darker nodes are the ones that have the largest effect on the structure.
The plot
image depicts the nt position on the top x axis, the original nt on the bottom x axis, the mutation that most changes the computed structure on the bottom x axis but inside the plot, the score = 1 - similarity on the y axis, so that the highest bar corresponds to the mutation that has the largest effect on the structure.
The structures
image depicts the graph encoding of the individual k mutations that most changes the computed structure. The title associated with each graph is composed of the original nt, the position and the mutation that most changes the computed structure. The node color encode the different nts (A|C|G|U
). The line encoding is the same as for the structure
plot (see above).
RaSE exposes several functions that can be used inside other projects. See examples of use in the Jupyter notebook
echo 'UCCAGUCGAGACCUGAAGUGGGUUUCCUGACGAGGCUGUGGAGAGAGCUUUCGCUUUACUCCCGCACAAGCCGAAACUGGA' | ./RaSE.py
((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
0 U G 0.63 .(((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))).
1 C G 0.70 ....((((((((((.....)))))))..)))..(((((((((((((((....))))).))))...)).)))).........
2 C G 0.70 ....((((((((((.....)))))))..)))..(((((((((((((((....))))).))))...)).)))).........
3 A C 0.61 ...(((((((((((.....)))))))..)))).(((((((((((((((....))))).))))...)).)))).........
4 G C 0.65 ((((((((.....)).))))))..(((......(((((((((((((((....))))).))))...)).))))......)))
5 U G 0.85 ((((((.(((((((.....))))))))......(((((((((((((((....))))).))))...)).))))....)))))
6 C U 0.87 ((((((((((((((.....))))))).......(((((((((((((((....))))).))))...)).))))..)))))))
7 G C 0.71 ((((((..((((((.....))))))........(((((((((((((((....))))).))))...)).))))...))))))
8 A C 0.36 ((((((..((((((.....))))..(((....))).((((((((((((....))))).)).))))).....))..))))))
9 G C 0.72 ((((((.((.((((.....)))).)).......(((((((((((((((....))))).))))...)).))))...))))))
10 A G 0.32 ((((((...(((.((..(((((......(.(((((((.(....).))).)))))......))))).)).)))...))))))
11 C G 0.36 ((((((...(.(((...(((((......(.(((((((.(....).))).)))))......)))))...))))...))))))
12 C U 0.28 ((((((((.(.((((..(((((......(.(((((((.(....).))).)))))......))))).))))))))..))))) *
13 U A 0.90 ((((((.((((((.......)))))).......(((((((((((((((....))))).))))...)).))))...))))))
14 G C 0.83 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
15 A U 0.87 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
16 A U 0.88 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
17 G U 0.95 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
18 U G 0.92 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
19 G C 0.72 ((((((.((((((.......)))))).......(((((((((((((((....))))).))))...)).))))...))))))
20 G C 0.58 ((((((.((((((......).))))).......(((((((((((((((....))))).))))...)).))))...))))))
21 G C 0.64 ((((((.((((((......)).)))).......(((((((((((((((....))))).))))...)).))))...))))))
22 U A 0.26 ((((((.((..((......))..))........(((((((((((((((....))))).))))...)).))))...)))))) *
23 U A 0.68 ((((((.((.((((.....)))).)).......(((((((((((((((....))))).))))...)).))))...))))))
24 U G 0.59 ((((((...(((((.....)))))((((....))))((((((((((((....))))).)).))))).........))))))
25 C G 0.65 ((((((..((((((.....))))))........(((((((((((((((....))))).))))...)).))))...))))))
26 C U 0.74 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
27 U G 0.64 ((((((.(((((((.....)))))))(((.....((.(.(((((((((....))))).))))))).....)))..))))))
28 G A 0.96 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
29 A G 0.68 ((((((.(((((((.....))))))).((((..(((.(.(((((((((....))))).))))))).)..))))..))))))
30 C G 0.88 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
31 G U 0.83 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
32 A G 0.76 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
33 G U 0.74 ((((((.(((((((.....))))))).......(((.(.(((((((((....))))).)))))))).........))))))
34 G C 0.74 ((((((.(((((((.....)))))))....((.((.((((((((((((....))))).))))...))).))))..))))))
35 C A 0.54 ((((((...(((((.....)))))((((....))))((((((((((((....))))).)).))))).........))))))
36 U C 0.65 ((((((.(((((((.....))))))).......(((((.(((((((((....))))).)))))).....)))...))))))
37 G C 0.28 ((((((.(((((((.....))))))).......(((((.(((((((((....))))).)))).)....))))...)))))) *
38 U A 0.79 ((((((.(((((((.....))))))).......((((..(((((((((....))))).))))......))))...))))))
39 G C 0.71 ((((((.(((((((.....))))))).......((((((((.((((((....)))...))).)).)).))))...))))))
40 G U 0.70 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))...)))).))))...))))))
41 A G 0.71 ((((((.(((((((.....))))))).......(((((((((((((((....)))...))))).))).))))...))))))
42 G U 0.76 ((((((.(((((((.....))))))).......((((((((.((((((....))))))...))))...))))...))))))
43 A C 0.55 ((((((.(((((((.....))))))).((.((.((..(((((((((....))))))))).)))))).........))))))
44 G C 0.31 ((((((((.(.(.((..(((((......(.(((((((((....))))).)))))......))))).)).)))))..))))) *
45 A U 0.69 ((((((.(((((((.....))))))).......((((((((.((((((....))...))))))))...))))...))))))
46 G C 0.68 ((((((.(((((((.....))))))).......((((((((.(((.............)))))))...))))...))))))
47 C U 0.67 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
48 U C 0.86 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
49 U G 0.96 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
50 U G 0.96 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
51 C U 0.94 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
52 G U 0.58 ((((((.(((((((.....))))))).((.((.((..(((((((((....))))))))).)))))).........))))))
53 C U 0.34 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
54 U A 0.39 ((((((.(((((((.....))))))).......((((((((.(((.((....))....)))))))...))))...))))))
55 U A 0.71 ((((((.(((((((.....))))))).......((((((((.((((((....)))...)))))))...))))...))))))
56 U C 0.71 ((((((.(((((((.....))))))).......((((((((.((((((....)))...)))))))...))))...))))))
57 A G 0.68 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
58 C U 0.75 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
59 U G 0.58 ((((((.(((((((.....))))))).......((((((((.((((((....))))).)..))))...))))...))))))
60 C U 0.74 ((((((.(((((((.....))))))).......(((((((((((((((....))))).).)))))...))))...))))))
61 C U 0.71 ((((((.(((((((.....))))))).......(((((((((((((((....)))...))))).))).))))...))))))
62 C G 0.64 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
63 G C 0.71 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
64 C G 0.65 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
65 A C 0.76 ((((((.(((((((.....))))))).......(((((((((((((((....))))).)).))))...))))...))))))
66 C G 0.60 ((((((..((((((.....))))))(((....)))(((((((((((((....))))).)).))))))........))))))
67 A C 0.72 ((((((.(((((((.....))))))).......(((((.(((((((((....))))).)))).....)))))...))))))
68 A G 0.28 ((((((.(((((((.....)))))))....((.(.(((((((((((((....))))).))))...)))).)))..)))))) *
69 G U 0.56 ((((((.(((((((.....)))))))....((.((.((((((((((((....))))).))))...))).))))..))))))
70 C G 0.32 ((((((..((((((.....))))))(((....)))....(((((((((....))))).))))(((.....)))..)))))) *
71 C G 0.52 ((((((..((((((.....))))))(((....))).....((((((((....))))).)))((((....))))..))))))
72 G U 0.90 ((((((.(((((((.....)))))))......((((((((((((((((....))))).))))...)).)))))..))))))
73 A G 0.75 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
74 A C 0.86 ((((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))))
75 A U 0.71 (((((..(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))....)))))
76 C U 0.74 ((((((((((((((.....)))))))..)))..(((((((((((((((....))))).))))...)).)))).....))))
77 U C 0.61 .((.((((((((((.....)))))))..)))..)).((((((((((((....))))).)).)))))....(((....))).
78 G U 0.57 ....((((((((((.....)))))))..)))..(((((((((((((((....))))).))))...)).)))).........
79 G C 0.72 ....((((((((((.....)))))))..)))..(((((((((((((((....))))).))))...)).)))).........
80 A C 0.73 .(((((.(((((((.....))))))).......(((((((((((((((....))))).))))...)).))))...))))).
RaSE - RNA structurAl Stability Estimate.
Compute stability.
Version: 1.1
Author: Fabrizio Costa [[email protected]]
Usage:
RaSE [-i <sequence>]
[-k N] [-c N, --complexity=N] [-n N, --nbits=N] [-w N, --window_size=N]
[-b N, --max_bp_span=N] [-p N, --avg_bp_prob_cutoff=N]
[-r N, --hard_threshold=N] [-e N, --max_num_edges=N]
[-l, --no_lonely_bps] [-t, --no_nesting]
[--draw] [--jpg | --svg | --png | --pdf]
[--verbose]
RaSE (-h | --help | --version)
Options:
-i <sequence> Specify input sequence [default: stdin].
-k N Specify number of maximally unstable
nucleotides to mark [default: 5].
-c N, --complexity=N Complexity of features [default: 3].
-n N, --nbits=N Num bits to represent all possible feature
pseudo identifiers [default: 15].
-w N, --window_size=N Window size [default: 150]
-b N, --max_bp_span=N Max number of spanning bases [default: 130]
-p N, --avg_bp_prob_cutoff=N Average probability cutoff [default: 0.1]
-r N, --hard_threshold=N Hard threshold [default: 0.5]
-e N, --max_num_edges=N Max num edges [default: 2]
-l, --no_lonely_bps Flag to activate no lonely base pairs mode.
-t, --no_nesting Flag to activate no nesting mode.
--draw Output drawing with standard name out.pdf.
--jpg Save images in jpg format.
--svg Save images in svg format.
--png Save images in png format.
--pdf Save images in pdf format.
-h --help Show this screen.
--version Show version.
--verbose Print more text.