-
Notifications
You must be signed in to change notification settings - Fork 27
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge branch 'master' into ct-beast_gpu_new_defaults
- Loading branch information
Showing
13 changed files
with
432 additions
and
43 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,295 @@ | ||
| version 1.0 | ||
|
|
||
| task qiime_import_from_bam { | ||
| meta { | ||
| description: "Parsing demultiplexed fastq BAM files into qiime readable files." | ||
| } | ||
| input { | ||
| File reads_bam | ||
| String sample_name | ||
| Int memory_mb = 2000 | ||
| Int cpu = 1 | ||
| Int disk_size_gb = ceil(2*size(reads_bam, "GiB")) + 5 | ||
| String docker = "quay.io/broadinstitute/qiime2:conda" | ||
| } | ||
| parameter_meta { | ||
| reads_bam: {description: "Input BAM file"} | ||
| } | ||
|
|
||
| command <<< | ||
| set -ex -o pipefail | ||
| #Part 1A | BAM -> FASTQ [Simple samtools command] | ||
| samtools fastq -1 $(pwd)/R1.fastq.gz -2 $(pwd)/R2.fastq.gz -0 /dev/null ~{reads_bam} | ||
| #making new bash variable | regex: (_) -> (-) | ||
| NEWSAMPLENAME=$(echo "~{sample_name}" | perl -lape 's/[_]/-/g') | ||
| #All names added to one giant file | ||
| echo ${NEWSAMPLENAME} > NEWSAMPLENAME.txt | ||
| #Make a manifest.txt that contains [1.sampleid 2.R1_fastq 3.R2.fastq] | ||
| #> =overwrite or writes new file | ||
| echo -e "sample-id\tforward-absolute-filepath\treverse-absolute-filepath" > manifest.tsv | ||
| #>>= appends | ||
| #\t= tabs next value | ||
| echo -e "$NEWSAMPLENAME\t$(pwd)/R1.fastq.gz\t$(pwd)/R2.fastq.gz" >> manifest.tsv | ||
|
|
||
| #fastq -> bam (provided by qiime tools import fxn) | ||
| qiime tools import \ | ||
| --type 'SampleData[PairedEndSequencesWithQuality]' \ | ||
| --input-path manifest.tsv \ | ||
| --input-format PairedEndFastqManifestPhred33V2 \ | ||
| --output-path "~{sample_name}.qza" | ||
| >>> | ||
|
|
||
| output { | ||
| File reads_qza = "~{sample_name}.qza" | ||
| String samplename_master_sheet = read_string("NEWSAMPLENAME.txt") | ||
| } | ||
| runtime { | ||
| docker: docker | ||
| memory: "${memory_mb} MiB" | ||
| cpu: cpu | ||
| disk: disk_size_gb + " GB" | ||
| disks: "local-disk " + disk_size_gb + " HDD" | ||
| } | ||
| } | ||
|
|
||
| #Part 1 | Step 2:cutadapt: Trim sequences | ||
| #trimreads_trim | ||
| #trim = default | ||
| task trim_reads { | ||
|
|
||
| meta { | ||
| description:"Removing adapter sequences, primers, and other unwanted sequence from sequence data." | ||
| } | ||
|
|
||
| input { | ||
| File reads_qza | ||
|
|
||
| String qza_basename = basename(reads_qza, '.qza') | ||
| #Boolean not_default = false | ||
| String forward_adapter = "CTGCTGCCTCCCGTAGGAGT" | ||
| String reverse_adapter = "AGAGTTTGATCCTGGCTCAG" | ||
| Int min_length = 1 | ||
| Boolean keep_untrimmed_reads = false | ||
| Int memory_mb = 2000 | ||
| Int cpu = 1 | ||
| Int disk_size_gb = ceil(2*size(reads_qza, "GiB")) + 5 | ||
| String docker = "quay.io/broadinstitute/qiime2:conda" | ||
| } | ||
|
|
||
| command <<< | ||
| set -ex -o pipefail | ||
| qiime cutadapt trim-paired \ | ||
| --i-demultiplexed-sequences "~{reads_qza}" \ | ||
| --p-front-f "~{forward_adapter}" \ | ||
| --p-front-r "~{reverse_adapter}" \ | ||
| ~{"--p-minimum-length " + min_length} \ | ||
| ~{true='--p-no-discard-untrimmed' false='--p-discard-untrimmed' keep_untrimmed_reads} \ | ||
| --o-trimmed-sequences "~{qza_basename}_trimmed.qza" | ||
|
|
||
| #trim_visual | ||
| qiime demux summarize \ | ||
| --i-data "~{qza_basename}_trimmed.qza" \ | ||
| --o-visualization "~{qza_basename}_trim_summary.qzv" | ||
| >>> | ||
|
|
||
| output { | ||
| #trimmed_sequences = paired ends for vsearch | ||
| File trimmed_reads_qza = "~{qza_basename}_trimmed.qza" | ||
| File trimmed_visualization = "~{qza_basename}_trim_summary.qzv" | ||
| } | ||
|
|
||
| runtime { | ||
| docker: docker | ||
| memory: "${memory_mb} MiB" | ||
| cpu: cpu | ||
| disk: disk_size_gb + " GB" | ||
| disks: "local-disk " + disk_size_gb + " HDD" | ||
| } | ||
| } | ||
|
|
||
| #Part 1 | Step 3:VSEARCH: Merge sequences | ||
| task join_paired_ends { | ||
| meta { | ||
| description: "Join paired-end sequence reads using vseach's merge_pairs function." | ||
| } | ||
| input { | ||
| #Input File: Merge paired reads | ||
| File trimmed_reads_qza | ||
| String reads_basename = basename(trimmed_reads_qza, '.qza') | ||
| Int memory_mb = 2000 | ||
| Int cpu = 1 | ||
| Int disk_size_gb = ceil(2*size(trimmed_reads_qza, "GiB")) + 5 | ||
| String docker = "quay.io/broadinstitute/qiime2:conda" | ||
| } | ||
|
|
||
| command <<< | ||
| set -ex -o pipefail | ||
| qiime vsearch join-pairs \ | ||
| --i-demultiplexed-seqs ~{trimmed_reads_qza} \ | ||
| --o-joined-sequences "~{reads_basename}_joined.qza" | ||
|
|
||
| qiime demux summarize \ | ||
| --i-data "~{reads_basename}_joined.qza" \ | ||
| --o-visualization "~{reads_basename}_visualization.qzv" | ||
| >>> | ||
| output { | ||
| File joined_end_reads_qza = "~{reads_basename}_joined.qza" | ||
| File joined_end_visualization = "~{reads_basename}_visualization.qzv" | ||
| } | ||
| runtime { | ||
| docker: docker | ||
| memory: "${memory_mb} MiB" | ||
| cpu: cpu | ||
| disk: disk_size_gb + " GB" | ||
| disks: "local-disk " + disk_size_gb + " HDD" | ||
| } | ||
| } | ||
|
|
||
| task deblur { | ||
|
|
||
| meta { | ||
| description: "Perform sequence quality control for Illumina data using the Deblur workflow with a 16S reference as a positive filter." | ||
| } | ||
| input { | ||
| File joined_end_reads_qza | ||
| String joined_end_basename = basename(joined_end_reads_qza, '.qza') | ||
| Int trim_length_var = 300 | ||
| Int memory_mb = 2000 | ||
| Int cpu = 1 | ||
| Int disk_size_gb = ceil(2*size(joined_end_reads_qza, "GiB")) + 5 | ||
| String docker = "quay.io/broadinstitute/qiime2:conda" | ||
| } | ||
| command <<< | ||
| set -ex -o pipefail | ||
|
|
||
| qiime deblur denoise-16S \ | ||
| --i-demultiplexed-seqs ~{joined_end_reads_qza} \ | ||
| ~{"--p-trim-length " + trim_length_var} \ | ||
| --p-sample-stats \ | ||
| --o-representative-sequences "~{joined_end_basename}_rep_seqs.qza" \ | ||
| --o-table "~{joined_end_basename}_table.qza" \ | ||
| --o-stats "~{joined_end_basename}_stats.qza" | ||
|
|
||
| #Generate feature table- give you the number of features per sample | ||
| qiime feature-table summarize \ | ||
| --i-table "~{joined_end_basename}_table.qza" \ | ||
| --o-visualization "~{joined_end_basename}_table.qzv" | ||
| #Generate visualization of deblur stats | ||
| qiime deblur visualize-stats \ | ||
| --i-deblur-stats "~{joined_end_basename}_stats.qza" \ | ||
| --o-visualization "~{joined_end_basename}_stats.qzv" | ||
| >>> | ||
| output { | ||
| File representative_seqs_qza = "~{joined_end_basename}_rep_seqs.qza" | ||
| File representative_table_qza = "~{joined_end_basename}_table.qza" | ||
| File feature_table = "~{joined_end_basename}_table.qzv" | ||
| File visualize_stats = "~{joined_end_basename}_stats.qzv" | ||
|
|
||
| } | ||
| runtime { | ||
| docker: docker | ||
| memory: "${memory_mb} MiB" | ||
| cpu: cpu | ||
| disk: disk_size_gb + " GB" | ||
| disks: "local-disk " + disk_size_gb + " HDD" | ||
| } | ||
| } | ||
| task train_classifier { | ||
| meta { | ||
| descrription: " Upload a classidier trained to classify v1-2 amplicon sequences" | ||
| } | ||
| input { | ||
| File otu_ref | ||
| File taxanomy_ref | ||
| String forward_adapter | ||
| String reverse_adapter | ||
| Int min_length = 100 | ||
| Int max_length = 500 | ||
| String otu_basename = basename(otu_ref, '.qza') | ||
| Int memory_mb = 2000 | ||
| Int cpu = 1 | ||
| Int disk_size_gb = ceil(2*size(otu_ref, "GiB")) + 5 | ||
| String docker = "quay.io/broadinstitute/qiime2:conda" | ||
| } | ||
| command <<< | ||
| set -ex -o pipefail | ||
| CONDA_ENV_NAME=$(conda info --envs -q | awk -F" " '/qiime.*/{ print $1 }') | ||
| conda activate ${CONDA_ENV_NAME} | ||
|
|
||
| qiime tools import \ | ||
| --type 'FeatureData[Sequence]' \ | ||
| --input-path ~{otu_ref} \ | ||
| --output-path "~{otu_basename}_seqs.qza" | ||
|
|
||
| qiime tools import \ | ||
| --type 'FeatureData[Taxonomy]' | ||
| --input-format HeaderlessTSVTaxonomyFormat \ | ||
| --input-path ~{taxanomy_ref} \ | ||
| --output-path "~{otu_basename}_tax.qza" | ||
|
|
||
| qiime feature-classifier extract-reads\ | ||
| --i-sequeunces "~{otu_basename}_seqs.qza"\ | ||
| --p-f-primer "~{forward_adapter}" \ | ||
| --p-r-primer "~{reverse_adapter}" \ | ||
| ~{"--p-min-length " + min_length} \ | ||
| ~{"--p-max-length " + max_length} \ | ||
| --o-reads "~{otu_basename}_v1-2-ref-seqs.qza" | ||
|
|
||
| qiime feature-classifier fit-classifier-naive-bayes \ | ||
| --i-reference-reads "~{otu_basename}_v1-2-ref-seqs.qza" \ | ||
| --i-reference-taxonomy "~{otu_basename}_tax.qza" \ | ||
| --o-classifier "~{otu_basename}_v1-2-classifier.qza" | ||
| >>> | ||
| output { | ||
| File trained_classifier = "~{otu_basename}_v1-2-classifier.qza" | ||
| } | ||
| runtime { | ||
| docker: docker | ||
| memory: "${memory_mb} MiB" | ||
| cpu: cpu | ||
| disk: disk_size_gb + " GB" | ||
| disks: "local-disk " + disk_size_gb + " HDD" | ||
| } | ||
| } | ||
| task tax_analysis { | ||
| meta { | ||
| description: "Protocol describes performing a taxonomic classification with a naive bayes classifier that has been trained on the V1-2 regions amplified by our primers." | ||
| } | ||
| input { | ||
| File trained_classifier | ||
| File representative_seqs_qza | ||
| File representative_table_qza | ||
| String basename = basename(trained_classifier, '.qza') | ||
| Int memory_mb = 5 | ||
| Int cpu = 1 | ||
| Int disk_size_gb = 375 | ||
| String docker = "quay.io/broadinstitute/qiime2:conda" | ||
| } | ||
| command <<< | ||
| set -ex -o pipefail | ||
| qiime feature-classifier classify-sklearn \ | ||
| --i-classifier ~{trained_classifier} \ | ||
| --i-reads ~{representative_seqs_qza} \ | ||
| --o-classification "~{basename}_tax.qza" | ||
|
|
||
| qiime feature-table tabulate-seqs \ | ||
| --i-data ~{representative_seqs_qza} \ | ||
| --o-visualization "~{basename}_rep_seqs.qzv" | ||
|
|
||
| qiime taxa barplot \ | ||
| --i-table ~{representative_table_qza} \ | ||
| --i-taxonomy "~{basename}_tax.qza" \ | ||
| --o-visualization "~{basename}_bar_plots.qzv" | ||
| >>> | ||
| output { | ||
| File rep_seq_list = "~{basename}_rep_seqs.qzv" | ||
| File tax_classification_graph = "~{basename}_bar_plots.qzv" | ||
| } | ||
| runtime { | ||
| docker: docker | ||
| memory: "7 GB" | ||
| cpu: cpu | ||
| disk: disk_size_gb + " GB" | ||
| disks: "local-disk " + disk_size_gb + " HDD" | ||
| } | ||
| } |
Oops, something went wrong.