barcode correction

[ruffyp]

Hello,

Could you please explain, what else should be considered for barcode correction besides the barcode sequence? For the same barcode – TGCCAAGTGCGTCTTGAGAACACCTGTATCG, I found one corrected in the BAM file, but not the other.

The contents of the Log.out file are shown below:

STAR version=2.7.11a
STAR compilation time,server,dir=2023-09-15T02:58:53+0000 :/opt/conda/conda-bld/star_1694746407721/work/source
##### Command Line:
STAR-avx2 --genomeDir GRCh38-2020-A --readFilesIn 0207_T1_S1_L001_R2_001.fastq.gz 0207_T1_S1_L001_R1_001.fastq.gz --soloBarcodeMate 0 --readFilesCommand zcat --soloCBwhitelist v1.txt --clip5pNbases 0 0 --soloType CB_UMI_Simple --soloBarcodeReadLength 0 --soloCBmatchWLtype 1MM_multi_Nbase_pseudocounts --soloCBstart 1 --soloCBlen 31 --soloUMIstart 35 --soloUMIlen 12 --soloUMIdedup 1MM_CR --soloUMIfiltering MultiGeneUMI_CR --soloCellFilter EmptyDrops_CR --clipAdapterType CellRanger4 --outFilterScoreMin 30 --soloMultiMappers EM --outSAMmultNmax 1 --outSAMunmapped Within --outSAMattributes NH NM GX GN UY UR UB CY CR CB --outSAMtype BAM SortedByCoordinate --outBAMsortingThreadN 36 --outBAMcompression -1 --soloFeatures GeneFull_Ex50pAS Gene SJ Velocyto --soloOutFileNames outs/ features.tsv barcodes.tsv matrix.mtx --runDirPerm All_RWX --runThreadN 36