Add "Get sequence" action to LGV rubber-band

[teresam856]

Issue 898

Get the reference sequence for the rubber-banded area.

Created get sequence dialog that opens when a section in the LGV rubber-band is selected.

TODO:
Pops up a modal dialog that has:

• button to copy to clipboard
• filename text field (with good default name)
• Regions selected contains out of bound coord
• Can select all regions
• Can select entire region
• Can select in between regions
• Can select multiple displayed Regions

Error Handling

• Disabled if there is no sequence adapter for the assembly in question
• Disabled (grayed out) if more than 500MB
• copy to clipboard (turned off if no clipboard support)
• textarea with the exported sequence in FASTA format, textarea is not displayed if more than 100KB of sequence

Tests

• tests for dialog opening/closing
• tests get selectedRegions
• test format and size of file

[codecov]

Codecov Report

Merging #1588 (111b2ed) into master (2c20e69) will increase coverage by 0.13%.
The diff coverage is 73.42%.

@@            Coverage Diff             @@
##           master    #1588      +/-   ##
==========================================
+ Coverage   58.98%   59.12%   +0.13%     
==========================================
  Files         439      441       +2     
  Lines       20108    20250     +142     
  Branches     4609     4654      +45     
==========================================
+ Hits        11861    11973     +112     
- Misses       7951     7978      +27     
- Partials      296      299       +3     

Impacted Files	Coverage Δ
...c/LinearGenomeView/components/LinearGenomeView.tsx	78.78% <60.00%> (-3.36%)	⬇️
...src/LinearGenomeView/components/SequenceDialog.tsx	63.41% <63.41%> (ø)
packages/core/util/Base1DViewModel.ts	77.20% <83.33%> (+5.43%)	⬆️
...iew/src/LinearGenomeView/components/RubberBand.tsx	85.34% <83.33%> (-0.52%)	⬇️
packages/core/rpc/coreRpcMethods.ts	85.24% <90.00%> (+0.93%)	⬆️
packages/core/util/formatFastaStrings.ts	100.00% <100.00%> (ø)
...s/linear-genome-view/src/LinearGenomeView/index.ts	80.61% <100.00%> (+0.39%)	⬆️
... and 1 more

---

Continue to review full report at Codecov.

Legend - Click here to learn more
Δ = absolute <relative> (impact), ø = not affected, ? = missing data
Powered by Codecov. Last update 2c20e69...111b2ed. Read the comment docs.

[teresam856]

Untitled.2.mov

[rbuels]

@scottcain look at that video ;-)

[elliothershberg]

🤩 Looks awesome! How tricky would it be to also support getting the locstring instead of sequence? Would be useful for certain use cases I think.

[cmdcolin]

I would maybe suggest that the "Get sequence" by default grabs FASTA, and that each displayed region is a section of FASTA with the locstring in the header so it might look like

>ctgA:1-100
ACGTACGTACGATCGATCGACGATCGATCGATCGATCGATGCTAGCTA

>ctgA:201-300
ACGTACGTACGATCGATCGACGATCGATCGATCGATCGATGCTAGCTA

[cmdcolin]

This is a bit of a weird idea but I thought maybe we could simplify the current implementation of getSelectedRegions using dynamicBlocks, since dynamicBlocks basically gives us the calculated "visible regions"...so I thought maybe we could use it to get selected regions too

I created a "simulated" Base1DView from a snapshot of the LinearGenomeView, and then simulate zoomToDisplayedRegions on it, and then get simulatedView.dynamicBlocks

https://github.com/GMOD/jbrowse-components/tree/898_get_sequence_mod

Random other thing but the branch also uses a monospace font for the textarea

[cmdcolin]

went ahead and merged ^_^ if there are any follow ups maybe we can do new issues but afaict it works good

[teresam856]

Jbrowse2_get_sequence.mov