From 5bfb8f80d6114a6d7c2556d061f310c94a9a695d Mon Sep 17 00:00:00 2001
From: siebrenf <siebrenf@gmail.com>
Date: Tue, 21 Jun 2022 17:33:10 +0200
Subject: [PATCH 1/9] update release_checklist

---
 docs/release_checklist.md | 17 +++++------------
 1 file changed, 5 insertions(+), 12 deletions(-)

diff --git a/docs/release_checklist.md b/docs/release_checklist.md
index 95546217..6378b729 100644
--- a/docs/release_checklist.md
+++ b/docs/release_checklist.md
@@ -63,37 +63,30 @@
 7. Push everything to github, including tags:
 
     ```shell
-    git push --follow-tags origin develop
+    git push --follow-tags origin develop master
     ```
 
-8. Pull into master
-
-    ```shell
-    git checkout master
-    git push origin master
-    ```
-
-9. Upload to pypi:
+8. Upload to pypi:
 
     ```shell
     python setup.py sdist bdist_wheel
     twine upload dist/genomepy-${new_version}*
     ```
 
-10. Create release on github (if it not already exists)
+9. Create release on github (if it not already exists)
 
     * Update release with CHANGELOG information from the latest version
     * Download the tarball from the github release (`.tar.gz`).
     * Attach downloaded tarball to release as binary (this way the download count get tracked).
 
-11a. Update bioconda package
+10a. Update bioconda package
 
     * wait for the bioconda bot to create a PR
     * update dependencies in the bioconda recipe.yaml if needed
     * approve the PR
     * comment: @bioconda-bot please merge
 
-11b. Update bioconda package
+10b. Update bioconda package
 
     * fork bioconda/bioconda-recipes
     * follow the steps in the [docs](https://bioconda.github.io/contributor/workflow.html)

From b016d8af4f44f2cf8251d03e8b4e76db6c1dbdf3 Mon Sep 17 00:00:00 2001
From: Brice Letcher <bletcher@ebi.ac.uk>
Date: Wed, 22 Jun 2022 09:48:51 +0100
Subject: [PATCH 2/9] Bugfix: CLI help menu not showing with no arguments
 (#210)

---
 genomepy/cli.py | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/genomepy/cli.py b/genomepy/cli.py
index e6a83ebe..3e062d30 100755
--- a/genomepy/cli.py
+++ b/genomepy/cli.py
@@ -188,7 +188,7 @@ def get_install_options():
 
     Add the provider name in front of the options to prevent overlap.
     """
-    if sys.argv[1] == "install":
+    if len(sys.argv) > 1 and sys.argv[1] == "install":
         install_options = INSTALL_OPTIONS
 
         # extend install options with provider specific options

From 02e23be52545b1697ba4513fd660d07775225530 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Siebren=20Fr=C3=B6lich?=
 <48289046+siebrenf@users.noreply.github.com>
Date: Thu, 21 Jul 2022 14:08:21 +0200
Subject: [PATCH 3/9] filelock 4 import + writing + deleting the cache (#212)

---
 CHANGELOG.md                  |  3 +++
 environment.yml               |  1 +
 genomepy/annotation/mygene.py |  3 ++-
 genomepy/caching.py           | 23 ++++++++++++++---------
 genomepy/providers/ensembl.py |  4 +++-
 genomepy/providers/gencode.py |  3 ++-
 genomepy/providers/ncbi.py    |  3 ++-
 genomepy/providers/ucsc.py    |  4 +++-
 setup.py                      |  1 +
 9 files changed, 31 insertions(+), 14 deletions(-)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 161040df..076872f6 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -6,6 +6,9 @@ The format is based on [Keep a Changelog](http://keepachangelog.com/en/1.0.0/).
 
 ## [Unreleased]
 
+### Added
+- now using `filelock` for improved thread safety
+
 ## [0.13.1] - 2022-06-21
 
 ### Changed
diff --git a/environment.yml b/environment.yml
index 50f0fae0..98ce0e7e 100644
--- a/environment.yml
+++ b/environment.yml
@@ -10,6 +10,7 @@ dependencies:
   - diskcache
   - click
   - colorama
+  - filelock
   - loguru
   - mygene
   - mysql-connector-python
diff --git a/genomepy/annotation/mygene.py b/genomepy/annotation/mygene.py
index ae9f90c5..2e7695f1 100644
--- a/genomepy/annotation/mygene.py
+++ b/genomepy/annotation/mygene.py
@@ -7,7 +7,7 @@
 from tqdm import tqdm
 
 from genomepy.annotation.utils import _parse_annot
-from genomepy.caching import cache_exp_short, disk_cache
+from genomepy.caching import cache_exp_short, disk_cache, lock
 
 
 def _map_genes(
@@ -78,6 +78,7 @@ def _map_genes(
     return df
 
 
+@lock
 @disk_cache.memoize(expire=cache_exp_short, tag="query_mygene")
 def query_mygene(
     query: Iterable[str],
diff --git a/genomepy/caching.py b/genomepy/caching.py
index 2a051df9..d7911a74 100644
--- a/genomepy/caching.py
+++ b/genomepy/caching.py
@@ -1,12 +1,13 @@
 import os
 from shutil import rmtree
-from sqlite3 import DatabaseError
-from time import sleep
+from time import time
 
 from appdirs import user_cache_dir
 from diskcache import Cache
+from filelock import FileLock
 
 from genomepy.__about__ import __version__
+from genomepy.utils import rm_rf
 
 # Set short/long cache expiration times (in seconds)
 cache_exp_short = 3.6e3
@@ -16,16 +17,20 @@
 genomepy_cache_dir = os.path.join(user_cache_dir("genomepy"), __version__)
 os.makedirs(genomepy_cache_dir, exist_ok=True)
 
-# Store the output of slow commands (marked with @disk_cache.memoize) for fast reuse
-# DiskCache uses the LRU (least-recently-stored) eviction policy by default
-try:
-    disk_cache = Cache(directory=genomepy_cache_dir)
-except DatabaseError:
-    # another process was writing to the cache at the same time
-    sleep(3)
+# create a lock, so only one tread can access the cache at once
+lock_file = os.path.join(genomepy_cache_dir, "cache.lock")
+if os.path.exists(lock_file) and time() - os.stat(lock_file).st_mtime > 60:
+    # remove abandoned lock
+    rm_rf(lock_file)
+lock = FileLock(lock_file)
+
+with lock:
+    # Store the output of slow commands (marked with @disk_cache.memoize) for fast reuse
+    # DiskCache uses the LRU (least-recently-stored) eviction policy by default
     disk_cache = Cache(directory=genomepy_cache_dir)
 
 
+@lock
 def clean():
     """Remove cached data on providers."""
     rmtree(genomepy_cache_dir, ignore_errors=True)
diff --git a/genomepy/providers/ensembl.py b/genomepy/providers/ensembl.py
index 4083a50a..58aaaaf0 100644
--- a/genomepy/providers/ensembl.py
+++ b/genomepy/providers/ensembl.py
@@ -3,7 +3,7 @@
 import requests
 from loguru import logger
 
-from genomepy.caching import cache_exp_long, cache_exp_short, disk_cache
+from genomepy.caching import cache_exp_long, cache_exp_short, disk_cache, lock
 from genomepy.exceptions import GenomeDownloadError
 from genomepy.online import check_url, retry
 from genomepy.providers.base import BaseProvider
@@ -65,6 +65,7 @@ def _genome_info_tuple(self, name, size=False):
         return name, accession, taxid, annotations, species, other
 
     @staticmethod
+    @lock
     @disk_cache.memoize(expire=cache_exp_short, tag="get_version-ensembl")
     def get_version(vertebrates=False, set_version=None, url=_url):
         """Retrieve current version from Ensembl FTP."""
@@ -237,6 +238,7 @@ def add_grch37(genomes):
     return genomes
 
 
+@lock
 @disk_cache.memoize(expire=cache_exp_long, tag="get_genomes-ensembl")
 def get_genomes(rest_url):
     logger.info("Downloading assembly summaries from Ensembl")
diff --git a/genomepy/providers/gencode.py b/genomepy/providers/gencode.py
index 0cf8f6b9..e88e681c 100644
--- a/genomepy/providers/gencode.py
+++ b/genomepy/providers/gencode.py
@@ -3,7 +3,7 @@
 
 from loguru import logger
 
-from genomepy.caching import cache_exp_long, disk_cache
+from genomepy.caching import cache_exp_long, disk_cache, lock
 from genomepy.exceptions import GenomeDownloadError
 from genomepy.files import update_readme
 from genomepy.online import check_url, connect_ftp_link
@@ -255,6 +255,7 @@ def _get_genomes(ftp_link):
     return genomes
 
 
+@lock
 @disk_cache.memoize(expire=cache_exp_long, tag="get_genomes-gencode")
 def get_genomes(ftp_link):
     """genomes dict of the latest gencode release of each major assembly."""
diff --git a/genomepy/providers/ncbi.py b/genomepy/providers/ncbi.py
index 9a26c41a..57cda613 100644
--- a/genomepy/providers/ncbi.py
+++ b/genomepy/providers/ncbi.py
@@ -8,7 +8,7 @@
 from loguru import logger
 from tqdm.auto import tqdm
 
-from genomepy.caching import cache_exp_long, disk_cache
+from genomepy.caching import cache_exp_long, disk_cache, lock
 from genomepy.exceptions import GenomeDownloadError
 from genomepy.online import check_url, read_url
 from genomepy.providers.base import BaseProvider
@@ -200,6 +200,7 @@ def _ftp_or_html_link(self, name, file_suffix, skip_check=False):
                 return link
 
 
+@lock
 @disk_cache.memoize(expire=cache_exp_long, tag="get_genomes-ncbi")
 def get_genomes(assembly_url):
     """Parse genomes from assembly summary txt files."""
diff --git a/genomepy/providers/ucsc.py b/genomepy/providers/ucsc.py
index 32bd7e6b..0fd5eda8 100644
--- a/genomepy/providers/ucsc.py
+++ b/genomepy/providers/ucsc.py
@@ -10,7 +10,7 @@
 import requests
 from loguru import logger
 
-from genomepy.caching import cache_exp_long, disk_cache
+from genomepy.caching import cache_exp_long, disk_cache, lock
 from genomepy.exceptions import GenomeDownloadError
 from genomepy.files import update_readme
 from genomepy.online import check_url, read_url
@@ -390,6 +390,7 @@ def head_annotation(self, name, genomes_dir=None, n: int = 5, **kwargs):
                             break
 
 
+@lock
 @disk_cache.memoize(expire=cache_exp_long, tag="get_genomes-ucsc")
 def get_genomes(rest_url):
     logger.info("Downloading assembly summaries from UCSC")
@@ -587,6 +588,7 @@ def download_annotation(name, annot, genomes_dir, localname, n=None):
     rm_rf(tmp_dir)
 
 
+@lock
 @disk_cache.memoize(expire=cache_exp_long, tag="scrape_accession-ucsc")
 def scrape_accession(htmlpath: str) -> str or None:
     """
diff --git a/setup.py b/setup.py
index fd337897..8c80172c 100644
--- a/setup.py
+++ b/setup.py
@@ -33,6 +33,7 @@
     "diskcache",
     "click",
     "colorama",
+    "filelock",
     "loguru",
     "mygene",
     "mysql-connector-python",

From d8bb778248eaafeeba49e80a3f88169d86bd3ab5 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Siebren=20Fr=C3=B6lich?=
 <48289046+siebrenf@users.noreply.github.com>
Date: Thu, 28 Jul 2022 19:53:34 +0200
Subject: [PATCH 4/9] switch to pyproject.toml (#211)

* pyproject.toml

* update pkg build system & info

* check all URLs per provider (#214)
---
 .flake8                           |   3 -
 .gitignore                        |  23 +++----
 .pre-commit-config.yaml           |  35 ----------
 .travis.yml                       |  10 +--
 CHANGELOG.md                      |   4 ++
 LICENSE                           |   2 +
 docs/release_checklist.md         |   8 +--
 docs/requirements.yaml            |   3 +-
 environment.yml                   |  24 +++----
 genomepy/annotation/__init__.py   |   4 +-
 genomepy/argparse_support.py      |   2 +-
 genomepy/cli.py                   |   7 +-
 genomepy/providers/__init__.py    |   3 +-
 genomepy/providers/ensembl.py     |   9 ++-
 genomepy/providers/gencode.py     |   7 +-
 genomepy/providers/local.py       |   2 +-
 genomepy/providers/ncbi.py        |   3 +-
 genomepy/providers/ucsc.py        |   4 +-
 genomepy/providers/url.py         |   2 +-
 pyproject.toml                    | 106 ++++++++++++++++++++++++++++++
 setup.py                          |  76 ---------------------
 tests/format.sh                   |   9 +--
 tests/test_07_provider_ncbi.py    |   9 ++-
 tests/test_09_provider_ensembl.py |   9 ++-
 24 files changed, 193 insertions(+), 171 deletions(-)
 delete mode 100644 .flake8
 delete mode 100644 .pre-commit-config.yaml
 create mode 100644 pyproject.toml
 delete mode 100644 setup.py

diff --git a/.flake8 b/.flake8
deleted file mode 100644
index e38efb34..00000000
--- a/.flake8
+++ /dev/null
@@ -1,3 +0,0 @@
-[flake8]
-extend-ignore = E203,E402,E501
-select = C,E,F,W,B,B950
diff --git a/.gitignore b/.gitignore
index 2704bdad..7c7d1f8f 100644
--- a/.gitignore
+++ b/.gitignore
@@ -11,14 +11,15 @@ Log.out
 genomepy/config/default.yaml
 
 # Directories
-docs/_autosummary
-docs/_build
-tests/data
-.pytest_cache
-build
-genomepy.egg-info
-dist
-eggs
-tmp
-.vscode
-.idea
+__pychache__/
+.idea/
+.pytest_cache/
+.vscode/
+build/
+dist/
+docs/_autosummary/
+docs/_build/
+eggs/
+genomepy.egg-info/
+tests/data/
+tmp/
diff --git a/.pre-commit-config.yaml b/.pre-commit-config.yaml
deleted file mode 100644
index c4ecb43a..00000000
--- a/.pre-commit-config.yaml
+++ /dev/null
@@ -1,35 +0,0 @@
-files: 'setup\.py|genomepy/.*|tests/.*'
-repos:
-  - repo: https://github.com/myint/autoflake
-    rev: v1.4
-    hooks:
-      - id: autoflake
-        args:
-          - --check
-          - --recursive
-          - --remove-all-unused-imports
-          - --remove-duplicate-keys
-          - --remove-unused-variables
-
-  - repo: https://github.com/pycqa/isort
-    rev: 5.9.1
-    hooks:
-      - id: isort
-        args:
-          - --check
-          - --profile=black
-          - --conda-env=environment.yml
-
-  - repo: https://github.com/ambv/black
-    rev: 21.5b2
-    hooks:
-    - id: black
-      args:
-        - --check
-
-  - repo: https://gitlab.com/pycqa/flake8
-    rev: 3.9.2
-    hooks:
-    - id: flake8
-      additional_dependencies:
-        - flake8-bugbear==21.4.3
diff --git a/.travis.yml b/.travis.yml
index ee22f059..30060638 100644
--- a/.travis.yml
+++ b/.travis.yml
@@ -7,7 +7,7 @@ branches:
 # use the minimal travis environment since we test in conda
 language: minimal
 
-#dist
+# dist
 dist: focal
 
 os:
@@ -18,7 +18,7 @@ env:
   global:
     - CC_TEST_REPORTER_ID=951f438ac8a0fa93801ff0bf69922df59fe03800bf7ea8ab77a3c26cda444979
   jobs:
-    - PYTHON_VERSION=3.6
+    - PYTHON_VERSION=3.7
 
 cache:
   directories:
@@ -43,14 +43,14 @@ before_install:
 
       export PATH=$HOME/miniconda/bin:$PATH;
       conda config --set always_yes yes;
-      conda install conda-forge::mamba;
+      conda update -c defaults conda;
+      conda install -c conda-forge mamba;
       mamba env create -n genomepy python=$PYTHON_VERSION -f environment.yml;
     fi
 
 install:
   - source activate genomepy
-  - python setup.py develop
-  - python setup.py build
+  - pip install -e .
 
 before_script:
   # install codeclimate test coverage
diff --git a/CHANGELOG.md b/CHANGELOG.md
index 076872f6..4a02476a 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -8,6 +8,10 @@ The format is based on [Keep a Changelog](http://keepachangelog.com/en/1.0.0/).
 
 ### Added
 - now using `filelock` for improved thread safety
+- now checking if every API/FTP/HTTP(S) is accessible before proceeding
+
+### Changed
+- switched to `pyproject.toml` + `hatchling` for packaging
 
 ## [0.13.1] - 2022-06-21
 
diff --git a/LICENSE b/LICENSE
index 945de80b..cb212e6e 100644
--- a/LICENSE
+++ b/LICENSE
@@ -1,3 +1,5 @@
+MIT License
+
 Copyright (c) 2016 Simon van Heeringen <simon.vanheeringen@gmail.com>
 
 Permission is hereby granted, free of charge, to any person
diff --git a/docs/release_checklist.md b/docs/release_checklist.md
index 6378b729..72e86343 100644
--- a/docs/release_checklist.md
+++ b/docs/release_checklist.md
@@ -28,13 +28,13 @@
 5. Check if release works on pypi:
 
     ```shell
-    python setup.py sdist bdist_wheel
+    python -m build
 
     # twine must be up to date (3.3.0 works). System installed twine can interfere.
     twine upload --repository-url https://test.pypi.org/legacy/ dist/genomepy-${new_version}*
 
-    python setup.py develop --uninstall
-   
+    pip uninstall genomepy
+
     # the \ is to escape the ==, so the variable ${new_version} can be called
     pip install --extra-index-url https://test.pypi.org/simple/ genomepy\==${new_version}
 
@@ -69,7 +69,7 @@
 8. Upload to pypi:
 
     ```shell
-    python setup.py sdist bdist_wheel
+    python -m build
     twine upload dist/genomepy-${new_version}*
     ```
 
diff --git a/docs/requirements.yaml b/docs/requirements.yaml
index e66afb06..23de0e35 100644
--- a/docs/requirements.yaml
+++ b/docs/requirements.yaml
@@ -5,5 +5,4 @@ channels:
 dependencies:
   - sphinx
   - sphinx_rtd_theme  # read the docs theme
-  - m2r2              # include markdown files
-  - mistune==0.8.4    # tmp until m2r2 0.3.2 is on conda
+  - m2r2 >=0.3.2      # include markdown files
diff --git a/environment.yml b/environment.yml
index 98ce0e7e..c2878459 100644
--- a/environment.yml
+++ b/environment.yml
@@ -4,9 +4,9 @@ channels:
   - conda-forge
   - defaults
 dependencies:
-  # Also found in setup.py
+  # Also found in pyproject.toml
   - appdirs
-  - biopython>=1.73  # for pyfaidx
+  - biopython >=1.73  # for pyfaidx
   - diskcache
   - click
   - colorama
@@ -14,12 +14,12 @@ dependencies:
   - loguru
   - mygene
   - mysql-connector-python
-  - norns>=0.1.5
+  - norns >=0.1.5
   - numpy
   - pandas
-  - pyfaidx>=0.5.7
+  - pyfaidx >=0.5.7
   - requests
-  - tqdm>=4.51
+  - tqdm >=4.51
 
   # Bgzip
   - tabix
@@ -40,15 +40,15 @@ dependencies:
   - star
 
   # Distribution
-  - setuptools
+  - python-build
 
   # Testing
-  - autoflake=1.4  # versions match .pre-commit-config.yaml
-  - black=21.5b2
-  - flake8=3.9.2
-  - flake8-bugbear=21.4.3
-  - isort=5.9.1
-  - pre-commit
+  - autoflake ==1.4
+  - black ==22.6.0
+  - flake8 ==4.0.1
+  - flake8-bugbear ==22.7.1
+  - flakeheaven ==2.0.0
+  - isort ==5.10.1
   - pytest
   - pytest-rerunfailures
   - pytest-cov
diff --git a/genomepy/annotation/__init__.py b/genomepy/annotation/__init__.py
index a62a0d26..a5514d95 100644
--- a/genomepy/annotation/__init__.py
+++ b/genomepy/annotation/__init__.py
@@ -167,7 +167,7 @@ def from_attributes(
                 raise ValueError(f"{field} not in GTF attributes!")
 
         # extract the text between the quotes
-        series = df["attribute"].str.extract(fr'{field} "(.*?)"', expand=False)
+        series = df["attribute"].str.extract(rf'{field} "(.*?)"', expand=False)
         series.name = field
         return series
 
@@ -444,7 +444,7 @@ def _get_name_and_dir(name, genomes_dir=None):
         name = safe(os.path.basename(fname))
         # remove suffices
         any_ext = "(" + ")|(".join(exts) + ")"
-        name = re.sub(fr"(\.annotation)?\.({any_ext})(\.gz)?$", "", name)
+        name = re.sub(rf"(\.annotation)?\.({any_ext})(\.gz)?$", "", name)
     elif os.path.isdir(fname):
         genome_dir = fname
         name = safe(os.path.basename(fname))
diff --git a/genomepy/argparse_support.py b/genomepy/argparse_support.py
index 329ccbcd..4c2524f0 100644
--- a/genomepy/argparse_support.py
+++ b/genomepy/argparse_support.py
@@ -15,7 +15,7 @@ def parse_genome(auto_install=False, genomes_dir=None):
         auto_install : bool, optional
             Install a genome if it's not found locally.
         genomes_dir : str, optional
-            Directory to look for and/or insall genomes.
+            Directory to look for and/or install genomes.
     """
 
     class GenomeAction(argparse.Action):
diff --git a/genomepy/cli.py b/genomepy/cli.py
index 3e062d30..2c62e172 100755
--- a/genomepy/cli.py
+++ b/genomepy/cli.py
@@ -314,7 +314,9 @@ def providers():
     "other_info": "<40",
 }
 FULL_SEARCH_STRING = " ".join([f"{{:{size}}}" for size in SEARCH_FORMAT.values()])
-SEARCH_STRING = " ".join([f"{{:{size}}}" for size in SEARCH_FORMAT.values() if size != "<13"])
+SEARCH_STRING = " ".join(
+    [f"{{:{size}}}" for size in SEARCH_FORMAT.values() if size != "<13"]
+)
 if sys.stdout.isatty():
 
     def bool_to_unicode(boolean: bool) -> str:
@@ -342,7 +344,7 @@ def terminal_formatting(row: list):
                 row[n] = "na"
         if len(row) == 8:
             # genome_size
-            row[6] = f'{int(row[6]):,}'
+            row[6] = f"{int(row[6]):,}"
             row = FULL_SEARCH_STRING.format(*row)
         else:
             row = SEARCH_STRING.format(*row)
@@ -364,6 +366,7 @@ def terminal_subheader(size):
             print(FULL_SEARCH_STRING.format(*subheader))
         else:
             print(SEARCH_STRING.format(*subheader[:-1]))
+
 else:
 
     def terminal_formatting(row: list):
diff --git a/genomepy/providers/__init__.py b/genomepy/providers/__init__.py
index f9ad5b00..2267e23d 100644
--- a/genomepy/providers/__init__.py
+++ b/genomepy/providers/__init__.py
@@ -98,7 +98,8 @@ def online_providers(provider: str = None):
     provider
         Provider instances
     """
-    for provider in [provider] if provider else list_providers():
+    providers = [provider] if provider else list_providers()
+    for provider in providers:
         try:
             yield create(provider)
         except ConnectionError as e:
diff --git a/genomepy/providers/ensembl.py b/genomepy/providers/ensembl.py
index 58aaaaf0..54f62bb5 100644
--- a/genomepy/providers/ensembl.py
+++ b/genomepy/providers/ensembl.py
@@ -50,7 +50,10 @@ def __init__(self):
     @staticmethod
     def ping():
         """Can the provider be reached?"""
-        return bool(check_url("https://rest.ensembl.org/info/ping?"))
+        api_online = bool(check_url("https://rest.ensembl.org/info/ping?"))
+        vertebrate_url_online = bool(check_url("http://ftp.ensembl.org"))
+        other_url_online = bool(check_url("http://ftp.ensemblgenomes.org"))
+        return api_online and vertebrate_url_online and other_url_online
 
     def _genome_info_tuple(self, name, size=False):
         """tuple with assembly metadata"""
@@ -111,7 +114,9 @@ def get_genome_download_link(self, name, mask="soft", **kwargs):
         #   - EnsemblMetazoa: caenorhabditis_elegans
         if not check_url(ftp_directory, 2):
             lwr_name = genome["name"]
-            ftp_directory = f"{ftp}/pub/release-{version}{div_path}/fasta/{lwr_name}/dna"
+            ftp_directory = (
+                f"{ftp}/pub/release-{version}{div_path}/fasta/{lwr_name}/dna"
+            )
 
         # this assembly has its own directory
         if name == "GRCh37":
diff --git a/genomepy/providers/gencode.py b/genomepy/providers/gencode.py
index e88e681c..307229c7 100644
--- a/genomepy/providers/gencode.py
+++ b/genomepy/providers/gencode.py
@@ -33,12 +33,12 @@ class GencodeProvider(BaseProvider):
         "text_search",
     ]
     _cli_install_options = {}
-    _ftp_link = "ftp://ftp.ebi.ac.uk/pub/databases/gencode"
+    _url = "ftp://ftp.ebi.ac.uk/pub/databases/gencode"
 
     def __init__(self):
         self._provider_status()
         # Populate on init, so that methods can be cached
-        self.genomes = _get_genomes(self._ftp_link)
+        self.genomes = _get_genomes(self._url)
         self.ucsc = UcscProvider()
         self.gencode2ucsc = get_gencode2ucsc(self.genomes)
         self._update_genomes()
@@ -46,7 +46,8 @@ def __init__(self):
     @staticmethod
     def ping():
         """Can the provider be reached?"""
-        return bool(check_url("ftp.ebi.ac.uk/pub/databases/gencode"))
+        ftp_online = bool(check_url("ftp.ebi.ac.uk/pub/databases/gencode"))
+        return ftp_online
 
     def _genome_info_tuple(self, name, size=False):
         """tuple with assembly metadata"""
diff --git a/genomepy/providers/local.py b/genomepy/providers/local.py
index 5e877fb8..fd2c668a 100644
--- a/genomepy/providers/local.py
+++ b/genomepy/providers/local.py
@@ -107,7 +107,7 @@ def get_annotation_download_links(self, name, **kwargs):
         hits = []
         for ext in ["gtf", "gff", "gff3"]:
             # .*? = non greedy filler. (\.gz)? = optional .gz
-            expr = fr"{search_name}.*?\.{ext}(\.gz)?"  # noqa: W605
+            expr = rf"{search_name}.*?\.{ext}(\.gz)?"  # noqa: W605
             for line in search_list:
                 hit = re.search(expr, line, flags=re.IGNORECASE)
                 if hit:
diff --git a/genomepy/providers/ncbi.py b/genomepy/providers/ncbi.py
index 57cda613..ddd0113c 100644
--- a/genomepy/providers/ncbi.py
+++ b/genomepy/providers/ncbi.py
@@ -56,7 +56,8 @@ def __init__(self):
     @staticmethod
     def ping():
         """Can the provider be reached?"""
-        return bool(check_url("https://ftp.ncbi.nlm.nih.gov/genomes/ASSEMBLY_REPORTS/"))
+        url_online = bool(check_url("https://ftp.ncbi.nlm.nih.gov/genomes/"))
+        return url_online
 
     def _genome_info_tuple(self, name, size=False):
         """tuple with assembly metadata"""
diff --git a/genomepy/providers/ucsc.py b/genomepy/providers/ucsc.py
index 0fd5eda8..7df89a5f 100644
--- a/genomepy/providers/ucsc.py
+++ b/genomepy/providers/ucsc.py
@@ -53,7 +53,9 @@ def __init__(self):
     @staticmethod
     def ping():
         """Can the provider be reached?"""
-        return bool(check_url("http://hgdownload.soe.ucsc.edu/goldenPath"))
+        url_online = bool(check_url("http://hgdownload.soe.ucsc.edu/goldenPath"))
+        api_online = bool(check_url("http://api.genome.ucsc.edu/list/ucscGenomes"))
+        return url_online and api_online
 
     def _search_accession(self, term: str) -> Iterator[str]:
         """
diff --git a/genomepy/providers/url.py b/genomepy/providers/url.py
index 617f840a..ede7e0fb 100644
--- a/genomepy/providers/url.py
+++ b/genomepy/providers/url.py
@@ -141,7 +141,7 @@ def fuzzy_annotation_search(search_name, search_list):
     hits = []
     for ext in ["gtf", "gff"]:
         # .*? = non greedy filler. 3? = optional 3 (for gff3). (\.gz)? = optional .gz
-        expr = fr"{search_name}.*?\.{ext}3?(\.gz)?"  # noqa: W605
+        expr = rf"{search_name}.*?\.{ext}3?(\.gz)?"  # noqa: W605
         for line in search_list:
             hit = re.search(expr, line, flags=re.IGNORECASE)
             if hit:
diff --git a/pyproject.toml b/pyproject.toml
new file mode 100644
index 00000000..87f47aa9
--- /dev/null
+++ b/pyproject.toml
@@ -0,0 +1,106 @@
+[project]
+name = "genomepy"
+description = "Genes and genomes at your fingertips"
+authors = [
+    {name = "Siebren Frölich", email = "siebrenf@gmail.com"},
+    {name = "Maarten van der Sande", email = "m.vandersande@science.ru.nl"},
+    {name = "Tilman Schäfers", email = "tilman.schaefers@ru.nl"},
+    {name = "Simon van Heeringen", email = "simon.vanheeringen@gmail.com"},
+]
+maintainers = [
+    {name = "Siebren Frölich", email = "siebrenf@gmail.com"},
+    {name = "Simon van Heeringen", email = "simon.vanheeringen@gmail.com"},
+]
+
+requires-python = ">=3.7"
+dependencies = [
+    "appdirs",
+    "biopython >=1.73",
+    "diskcache",
+    "click",
+    "colorama",
+    "filelock",
+    "loguru",
+    "mygene",
+    "mysql-connector-python",
+    "norns >=0.1.5",
+    "numpy",
+    "pandas",
+    "pyfaidx >=0.5.7",
+    "requests",
+    "tqdm >=4.51",
+]
+
+dynamic = ["version"]
+readme = "README.md"
+license = {file = "LICENSE"}
+classifiers = [
+    "Development Status :: 4 - Beta",
+    "Intended Audience :: Developers",
+    "Intended Audience :: Science/Research",
+    "License :: OSI Approved :: MIT License",
+    "Operating System :: MacOS :: MacOS X",
+    "Operating System :: POSIX :: Linux",
+    "Programming Language :: Python",
+    "Programming Language :: Python :: 3",
+    "Topic :: Scientific/Engineering :: Bio-Informatics",
+]
+keywords = [
+    "genome",
+    "assembly",
+    "gene",
+    "annotation",
+    "Ensembl",
+    "UCSC",
+    "NCBI",
+    "GENCODE",
+]
+
+[project.urls]
+Homepage = "https://github.com/vanheeringen-lab/genomepy"
+Documentation = "https://vanheeringen-lab.github.io/genomepy/"
+News = "https://github.com/vanheeringen-lab/genomepy/blob/master/CHANGELOG.md"
+Readme = "https://github.com/vanheeringen-lab/genomepy/blob/master/README.md"
+
+[project.scripts]
+genomepy = "genomepy.cli:cli"
+
+# pyproject.toml documentation:
+# https://peps.python.org/pep-0621/
+# https://hatch.pypa.io/latest/config/metadata/
+# https://setuptools.pypa.io/en/latest/userguide/pyproject_config.html
+# https://python-poetry.org/docs/pyproject/
+
+[build-system]
+requires = ["hatchling>=1.5.0"]
+build-backend = "hatchling.build"
+
+[tool.hatch.version]
+path = "genomepy/__about__.py"
+
+# include files specified in .gitignore
+[tool.hatch.build]
+artifacts = [
+    "genomepy/config/default.yaml",
+]
+
+# # include other files
+# [tool.hatch.build.force-include]
+# "LICENSE" = "genomepy/LICENSE"
+# "README.md" = "genomepy/README.md"
+# "CHANGELOG.md" = "genomepy/CHANGELOG.md"
+
+[tool.isort]
+profile = "black"
+conda_env = "environment.yml"
+overwrite_in_place = true
+
+[tool.flakeheaven]
+max_line_length = 88
+show_source = true
+
+[tool.flakeheaven.plugins]
+flake8-bugbear = ["+*"]
+pycodestyle = ["+*", "-E501", "-W503"]
+pyflakes = ["+*"]
+pylint = ["+*"]
diff --git a/setup.py b/setup.py
deleted file mode 100644
index 8c80172c..00000000
--- a/setup.py
+++ /dev/null
@@ -1,76 +0,0 @@
-import os
-import sys
-
-from setuptools import setup
-
-# https://packaging.python.org/single_source_version/
-exec(open("genomepy/__about__.py").read())
-
-if sys.argv[-1] == "publish":
-    os.system("python setup.py sdist upload")
-    sys.exit()
-
-with open("README.md", encoding="utf-8") as f:
-    long_description = f.read()
-
-# List of files and directories to include when packaging for release
-packages = [
-    "genomepy",
-    "genomepy.annotation",
-    "genomepy.config",
-    "genomepy.genome",
-    "genomepy.plugins",
-    "genomepy.providers",
-]
-package_data = {"genomepy": ["config/default.yaml"]}
-data_files = [("", ["LICENSE", "README.md", "CHANGELOG.md"])]
-
-entry_points = {"console_scripts": ["genomepy=genomepy.cli:cli"]}
-
-requires = [
-    "appdirs",
-    "biopython>=1.73",
-    "diskcache",
-    "click",
-    "colorama",
-    "filelock",
-    "loguru",
-    "mygene",
-    "mysql-connector-python",
-    "norns>=0.1.5",
-    "numpy",
-    "pandas",
-    "pyfaidx>=0.5.7",
-    "requests",
-    "tqdm>=4.51",
-]
-
-classifiers = [
-    "Development Status :: 4 - Beta",
-    "Intended Audience :: Developers",
-    "Intended Audience :: Science/Research",
-    "License :: OSI Approved :: MIT License",
-    "Operating System :: MacOS :: MacOS X",
-    "Operating System :: POSIX :: Linux",
-    "Programming Language :: Python",
-    "Programming Language :: Python :: 3",
-    "Topic :: Scientific/Engineering :: Bio-Informatics",
-]
-
-setup(
-    name="genomepy",
-    version=__version__,  # noqa: F821
-    description="Automatic downloading and processing of genomes and metadata in command line and Python",
-    long_description=long_description,
-    long_description_content_type="text/markdown",
-    packages=packages,
-    package_data=package_data,
-    data_files=data_files,
-    entry_points=entry_points,
-    install_requires=requires,
-    author=__author__,  # noqa: F821
-    author_email="simon.vanheeringen@gmail.com",
-    url="https://github.com/vanheeringen-lab/genomepy",
-    license="MIT",
-    classifiers=classifiers,
-)
diff --git a/tests/format.sh b/tests/format.sh
index eb9c9a9e..b832705a 100755
--- a/tests/format.sh
+++ b/tests/format.sh
@@ -7,13 +7,10 @@ Run from root directory to format:
   bash tests/format.sh
 Run from root directory to lint:
   bash tests/format.sh lint
-
-Tool versions must match the pre-commit hook to prevent later issues.
-This is automatically fixes if installed with `conda env create -f environment.yml`
 '
 
 # files & directories to format/lint
-targets=("setup.py genomepy/ tests/")
+targets=("genomepy/ tests/")
 
 # check current directory
 if [[ $(pwd) != *genomepy ]] || [[ $(ls) != *genomepy* ]]; then
@@ -55,8 +52,8 @@ black \
   | grep 'would reformat'
 
 if $lint; then
-  flake8 \
-    $targets
+  flakeheaven lint \
+  $targets
 
   echo ""
   echo "Done"
diff --git a/tests/test_07_provider_ncbi.py b/tests/test_07_provider_ncbi.py
index e3fc17e1..b229f385 100644
--- a/tests/test_07_provider_ncbi.py
+++ b/tests/test_07_provider_ncbi.py
@@ -15,7 +15,14 @@ def test_ncbiprovider(ncbi):
 def test_genome_info_tuple(ncbi):
     t = ncbi._genome_info_tuple("ASM2732v1", size=True)
     assert isinstance(t, tuple)
-    assert t[:-1] == ("ASM2732v1", "GCF_000027325.1", 2097, True, 'Mycoplasma genitalium G37', 580076)
+    assert t[:-1] == (
+        "ASM2732v1",
+        "GCF_000027325.1",
+        2097,
+        True,
+        "Mycoplasma genitalium G37",
+        580076,
+    )
 
 
 def test_get_genome_download_link(ncbi):
diff --git a/tests/test_09_provider_ensembl.py b/tests/test_09_provider_ensembl.py
index 51882990..fb61df8f 100644
--- a/tests/test_09_provider_ensembl.py
+++ b/tests/test_09_provider_ensembl.py
@@ -12,7 +12,14 @@ def test_ensemblprovider(ensembl):
 def test_genome_info_tuple(ensembl):
     t = ensembl._genome_info_tuple("KH", size=True)
     assert isinstance(t, tuple)
-    assert t[:-1] == ("KH", "GCA_000224145.1", 7719, True, 'Ciona intestinalis', 115227500)
+    assert t[:-1] == (
+        "KH",
+        "GCA_000224145.1",
+        7719,
+        True,
+        "Ciona intestinalis",
+        115227500,
+    )
 
 
 def test_get_version(ensembl):

From cfc389fdb7390c66d6545ce36d1b59c30a9882f9 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Siebren=20Fr=C3=B6lich?=
 <48289046+siebrenf@users.noreply.github.com>
Date: Mon, 1 Aug 2022 13:43:53 +0200
Subject: [PATCH 5/9] improve search + update docs (#216)

---
 CHANGELOG.md                   |   6 ++
 README.md                      | 146 ++++++++++++++++++---------------
 docs/content/about.rst         |   2 +-
 docs/content/command_line.rst  |   4 +-
 docs/content/help_faq.rst      |   4 +-
 docs/content/installation.rst  |   4 +-
 genomepy/cli.py                |   9 +-
 genomepy/providers/__init__.py |  11 ++-
 genomepy/providers/base.py     |  36 ++++----
 tests/test_06_provider_base.py |   2 +-
 10 files changed, 125 insertions(+), 99 deletions(-)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 4a02476a..c680fbe6 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -9,10 +9,16 @@ The format is based on [Keep a Changelog](http://keepachangelog.com/en/1.0.0/).
 ### Added
 - now using `filelock` for improved thread safety
 - now checking if every API/FTP/HTTP(S) is accessible before proceeding
+- genomepy search improvements:
+  - text search now accepts regex, and multiple substrings (space separated) are unordered.
+  - taxonomy search now returns all hits that start with the given number.
 
 ### Changed
 - switched to `pyproject.toml` + `hatchling` for packaging
 
+### Fixed
+- updated the README and CLI documentation to mention the `Local` provider
+
 ## [0.13.1] - 2022-06-21
 
 ### Changed
diff --git a/README.md b/README.md
index 5474b6b9..e0f49e76 100644
--- a/README.md
+++ b/README.md
@@ -1,9 +1,9 @@
-# genomepy
+# genomepy: genes and genomes at your fingertips
 
 [![bioconda-badge](https://img.shields.io/badge/install%20with-bioconda-brightgreen.svg?style=flat)](http://bioconda.github.io)
 [![Anaconda-Server Badge](https://anaconda.org/bioconda/genomepy/badges/downloads.svg)](https://anaconda.org/bioconda/genomepy)
 [![PyPI version](https://badge.fury.io/py/genomepy.svg)](https://badge.fury.io/py/genomepy)
-[![star this repo](https://githubbadges.com/star.svg?user=vanheeringen-lab&repo=genomepy&style=flat)](https://github.com/vanheeringen-lab/genomepy)
+<!--- [![star this repo](https://githubbadges.com/star.svg?user=vanheeringen-lab&repo=genomepy&style=flat)](https://github.com/vanheeringen-lab/genomepy) -->
 
 [![Build Status](https://app.travis-ci.com/vanheeringen-lab/genomepy.svg?branch=master)](https://app.travis-ci.com/github/vanheeringen-lab/genomepy/branches)
 [![Maintainability](https://api.codeclimate.com/v1/badges/c4476820f1d21a3e0569/maintainability)](https://codeclimate.com/github/vanheeringen-lab/genomepy/maintainability)
@@ -12,14 +12,13 @@
 [![status](http://joss.theoj.org/papers/df434a15edd00c8c2f4076668575d1cd/status.svg)](http://joss.theoj.org/papers/df434a15edd00c8c2f4076668575d1cd)
 [![DOI](https://zenodo.org/badge/DOI/10.5281/zenodo.1010458.svg)](https://doi.org/10.5281/zenodo.1010458)
 
-Install and use genomes & gene annotations the easy way!
-
 genomepy is designed to provide a _simple_ and _straightforward_ way to download and use genomic data.
-This includes (1) searching available data, (2) showing the available metadata,
+This includes (1) searching available data, 
+(2) showing the available metadata,
 (3) automatically downloading, preprocessing and matching data and
 (4) generating optional aligner indexes.
 All with sensible, yet controllable defaults.
-Currently, genomepy supports UCSC, Ensembl and NCBI. 
+Currently, genomepy supports Ensembl, UCSC, NCBI and GENCODE. 
 
 [![asciicast](https://asciinema.org/a/eZttBuf5ly0AnjFVBiEIybbjS.png)](https://asciinema.org/a/eZttBuf5ly0AnjFVBiEIybbjS)
 
@@ -43,27 +42,31 @@ Don't be shy and [let us know](https://github.com/vanheeringen-lab/genomepy/issu
 
 ## Installation
 
-genomepy requires Python 3.6+
+genomepy requires Python 3.7+
 
 You can install genomepy via [bioconda](https://bioconda.github.io/):
 
-```
-$ conda install genomepy
+```bash
+$ conda install -c bioconda genomepy
 ``` 
 
 Or via pip:
 
-```
+```bash
 $ pip install genomepy
 ```
 
 Or via git:
 
-```
+```bash
 $ git clone https://github.com/vanheeringen-lab/genomepy.git
 $ cd genomepy
-$ conda env update -f environment.yml
-$ python setup.py install
+
+# optional:
+$ conda env create -n genomepy -f environment.yml
+$ conda activate genomepy
+
+$ pip install -e .
 ```
 
 With Pip installation, you will have to install additional dependencies, and make them available in your PATH.
@@ -85,7 +88,7 @@ You can find the binaries [here](http://hgdownload.cse.ucsc.edu/admin/exe/).
 1.  Find your genome: `$ genomepy search zebrafish`
 
   Console output:
-  ```
+  ```bash
   name      provider    accession           tax_id     annotation    species        other_info
   GRCz11    Ensembl     GCA_000002035.4     7955       ✓             Danio rerio    2017-08-Ensembl/2018-04
    ^
@@ -94,18 +97,18 @@ You can find the binaries [here](http://hgdownload.cse.ucsc.edu/admin/exe/).
 
 2.  Install your genome (with annotation): `$ genomepy install --annotation GRCz11 --provider ensembl `
 
-  Default genome directory: `~/.local/share/genomes/`
+The default genomes directory: `~/.local/share/genomes/`
 
 ## Plugins and indexing
 
-By default genomepy generates support files, including a genome index,
+By default, genomepy generates support files including a genome index,
 chromosome sizes and gap locations (Ns in the sequence).
 
-For some genomes genomepy can download blacklist files (generated by the Kundaje lab). 
-This will only work when installing these genomes from UCSC.
-Enable this plugin to use it.
+For some model organisms, genomepy can download a genome blacklist (generated by the Kundaje lab). 
+Blacklists are only available for these model organisms when downloaded from UCSC, and for the human and mouse genomes.
+Enable the blacklist plugin to use it.
 
-```
+```bash
 $ genomepy plugin enable blacklist
 ```
 
@@ -122,11 +125,12 @@ Currently, genomepy supports:
 Note 1: these programs are not installed by genomepy and need to be
 installed separately for the indexing to work.
 
-Note 2: splice-aware indexing is performed by Hisat2 and STAR.
+Note 2: splice-aware indexing (required for e.g. RNA-seq) is performed by STAR and Hisat2.
 Splice-aware indexing requires the annotation to be downloaded as well. 
 You will receive a warning if indexing is performed without annotation for these aligners.
 
-Note 3: STAR can further improve mapping to (novel) splice junctions by indexing again (2-pass mapping mode). 
+Note 3: STAR can further improve mapping to (novel) splice junctions by indexing again 
+(see 2-pass mapping mode in the STAR manual). 
 The second pass is not supported by genomepy.
 
 You can configure the index creation using the `genomepy plugin` command (see below)
@@ -135,25 +139,25 @@ You can configure the index creation using the `genomepy plugin` command (see be
 
 To change the default configuration, generate a personal config file:
 
-```
+```bash
 $ genomepy config generate
 Created config file /home/simon/.config/genomepy/genomepy.yaml
 ```
 
 ### Genome location
 
-By default genomes will be saved in `~/.local/share/genomes`. 
+By default, genomes will be saved in `~/.local/share/genomes`. 
 
 To set the default genome directory, to `/data/genomes` for instance,
 edit `~/.config/genomepy/genomepy.yaml` and change the following line:
 
-```
+```bash
 genomes_dir: ~/.local/share/genomes/
 ```
 
 to:
 
-```
+```bash
 genomes_dir: /data/genomes
 ```
 
@@ -165,7 +169,7 @@ Optionally genome FASTA files can be saved using bgzip compression.
 This means that the FASTA files will take up less space on disk.
 To enable this use the flag `--bgzip` on the command line, or add the following line to your config file:
 
-```
+```bash
 bgzip: True
 ```
 
@@ -180,7 +184,7 @@ which comes installed with genomepy.
 
 All functions come with a short explanation when appended with `--help`.
 
-```
+```bash
 $ genomepy --help
 Usage: genomepy [OPTIONS] COMMAND [ARGS]...
 
@@ -203,8 +207,8 @@ Commands:
 
 Find the name of your desired genome:
 
-```
-$ genomepy search xenopus tropicalis
+```bash
+$ genomepy search xenopus tro
 name                       provider    accession           tax_id    annotation     species               other_info
                                                                       n r e k
 Xenopus_tropicalis_v9.1    Ensembl     GCA_000004195.3       8364        ✓          Xenopus tropicalis    2019-04-Ensembl/2019-12
@@ -224,7 +228,7 @@ ASM1336827v1               NCBI        GCA_013368275.1       8364        ✗
 You can search by genome name (case-insensitive), taxonomy ID or assembly accession ID.
 Additionally, you can limit the search result to one provider with `-p`/`--provider`.
 
-```
+```bash
 $ genomepy search 8364 -p ucsc
 name                    provider    accession           tax_id    annotation     species               other_info
                                                                    n r e k
@@ -237,16 +241,16 @@ xenTro9                 UCSC        GCA_000004195.3       8364     ✓ ✓ ✓ 
  Use name for genomepy install
 ```
 
-Lets say we want to download the latest *Xenopus tropicalis* genome from UCSC.
+Let's say we want to download a *Xenopus tropicalis* genome from UCSC.
 
 If you are interested in the gene annotation as well, you might want to check which gene annotation suits your needs.
-Because we're looking at UCSC there are several options for us to choose from.
+Because we're looking at UCSC, and there are several options for us to choose from.
 In the search results, `n r e k ` denotes which UCSC annotations are available. 
 These stand for **n**cbiRefSeq, **r**efGene, **e**nsGene and **k**nownGene, respectively.
 
 We can quickly inspect these with the `genomepy annotation` command:
 
-```
+```bash
 $ genomepy annotation xenTro9 -p ucsc
 12:04:41 | INFO | UCSC ncbiRefSeq
 chr1    genomepy        transcript      133270  152620  .       -       .       gene_id "LOC100490505"; transcript_id "XM_012956089.1";  gene_name "LOC100490505";
@@ -260,11 +264,12 @@ chr1    genomepy        exon    133270  134186  .       -       .       gene_id
 ```
 
 Here we can see that the `refGene` annotation has actual HGNC gene names, so lets go with this annotation.
+This differs between genomes, so be sure to check!
 
 Copy the name returned by the search function to install.
 For UCSC we can also select the annotation type.
 
-```
+```bash
 $ genomepy install xenTro9 --UCSC-annotation refGene
 ```
 
@@ -272,7 +277,7 @@ Since we did not specify the provider here, genomepy will use the first provider
 Since we learned in `genomepy search` that only UCSC uses this name, it will be UCSC.
 We can also specify genomepy to use UCSC by giving it the provider name with `-p`/`--provider`:
 
-```
+```bash
 $ genomepy install xenTro9 -p UCSC
 Downloading genome from http://hgdownload.soe.ucsc.edu/goldenPath/xenTro9/bigZips/xenTro9.fa.gz...
 Genome download successful, starting post processing...
@@ -285,7 +290,7 @@ fasta: /data/genomes/xenTro9/xenTro9.fa
 Next, the genome is downloaded to the directory specified in the config file.
 To choose a different directory, use the `-g`/`--genomes_dir` option:
 
-```
+```bash
 $ genomepy install sacCer3 -p UCSC -g /path/to/my/genomes
 Downloading genome from http://hgdownload.soe.ucsc.edu/goldenPath/sacCer3/bigZips/chromFa.tar.gz...
 Genome download successful, starting post processing...
@@ -299,7 +304,7 @@ You can use a regular expression to filter for matching sequences
 (or non-matching sequences by using the `--no-match` option).
 For instance, the following command downloads hg38 and saves only the major chromosomes:
 
-```
+```bash
 $ genomepy install hg38 -p UCSC -r 'chr[0-9XY]+$'
 downloading from http://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz...
 done...
@@ -336,34 +341,41 @@ $ grep ">" /data/genomes/hg38/hg38.fa
 
 By default, sequences are soft-masked. Use `-m hard` for hard masking, or `-m none` for no masking.
 
-The chromosome sizes are saved in file called `<genome_name>.fa.sizes`.
-
 You can choose to download gene annotation files with the `--annotation` option. 
 These will be saved in (gzipped) BED and GTF format. 
 
-```
+```bash
 $ genomepy  install hg38 -p UCSC --annotation
 ```
 
+All selected options are stored in a `README.txt`. 
+This includes the original name, download location and other genomepy operations (such as regex filtering and time).
+
+###### Additional providers
+
 To facilitate the downloading of genomes not supported by either NCBI, UCSC, or Ensembl, genomes 
-can also be downloaded directly from an url:
+can also be downloaded directly from an url, by specifying `URL` as the provider:
 
-```
+```bash
 $ genomepy install -p url https://research.nhgri.nih.gov/hydra/download/assembly/\Hm105_Dovetail_Assembly_1.0.fa.gz
 ```
-This installs the genome under the filename of the link, but can be changed with the `--localname` option
 
-If you add the `--annotation` flag, genomepy will search the remote directory for an annotation file as well.
-Should this fail, you can also add a url to the annotation with `--URL-to-annotation`.
+This installs the genome under the filename of the link, but can be changed with the `--localname` option.
+Similarly, if you have a local fasta file, you can install this using the filepath and specifying `Local` as the provider.
 
-Finally, in the spirit of reproducibility all selected options are stored in a `README.txt`. 
-This includes the original name, download location and other genomepy operations (such as regex filtering and time).
+If you add the `--annotation` flag, genomepy will search the (remote) directory for an annotation file as well.
+Should this fail, you can also add a URL to the annotation with `--URL-to-annotation` with the `URL` provider, 
+or a filepath with `--Local-path-to-annotation` with the `Local` provider:
+
+```bash
+$ genomepy install -p local /path/to/genome.fa --Local-path-to-annotation /path/to/gene.annotation.gtf
+```
 
 #### Manage plugins.
 
 Use `genomepy plugin list` to view the available plugins.
 
-```
+```bash
 $ genomepy plugin list
 plugin              enabled
 bowtie2             
@@ -377,14 +389,14 @@ blacklist
 
 Enable plugins as follows:
 
-```
+```bash
 $ genomepy plugin enable bwa hisat2
 Enabled plugins: bwa, hisat2
 ```
 
 And disable like this:
 
-```
+```bash
 $ genomepy plugin disable bwa
 Enabled plugins: hisat2
 ```
@@ -394,7 +406,7 @@ Enabled plugins: hisat2
 You can search by genome name (case-insensitive), taxonomy ID or assembly accession ID.
 Additionally, you can limit the search result to one provider with `-p`/`--provider`.
 
-```
+```bash
 $ genomepy search xenopus tropicalis
 name                       provider    accession           tax_id    annotation     species               other_info
                                                                       n r e k
@@ -414,7 +426,7 @@ ASM1336827v1               NCBI        GCA_013368275.1       8364        ✗
 
 Only search a specific provider:
 
-```
+```bash
 $ genomepy search tropicalis -p ucsc
 name                    provider    accession           tax_id    annotation     species               other_info
                                                                    n r e k
@@ -431,20 +443,22 @@ Note that searching doesn't work flawlessly, so try a few variations if you don'
 
 #### List available providers
 
-```
+```bash
 $ genomepy providers
+GENCODE
 Ensembl
 UCSC
 NCBI
+Local
 URL
 ```
 
 #### List available genomes
 
-You can constrain the genome list by using the `-p` option to search only a 
-specific provider. 
+You can constrain the genome list by using the `-p`/`--provider` option to search only a specific provider.
+Additionally, you can get the absolute `--size` of each genome (this option slows down the search).
 
-```
+```bash
 $ genomepy genomes -p UCSC
 name                    provider    accession          tax_id     annotation     species                                     other_info
                                                                    n r e k
@@ -457,14 +471,14 @@ anoCar1                 UCSC        na                  28377      ✗ ✗ ✓ 
 
 List the current configuration file that genomepy uses:
 
-```
+```bash
 $ genomepy config file
 /home/simon/.config/genomepy/genomepy.yaml
 ```
 
 To show the contents of the config file:
 
-```
+```bash
 $ genomepy config show
 # Directory were downloaded genomes will be stored
 genomes_dir: ~/.local/share/genomes/
@@ -475,7 +489,7 @@ plugin:
 
 To generate a personal configuration file (existing file will be overwritten):
 
-```
+```bash
 $ genomepy config generate
 Created config file /home/simon/.config/genomepy/genomepy.yaml
 ```
@@ -528,8 +542,8 @@ fasta: ./data/genomes/hg38/hg38.fa
 tgtatggtccctagaggggccagagtcacagagatggaaagtggatggcgggtgccgggggctggggagctactgtgcagggggacagagctttagttct
 ```
 
-The `genomepy.Genome()` method returns a Genome object. This has all the
-functionality of a `pyfaidx.Fasta` object, 
+The `genomepy.Genome()` method returns a Genome object. 
+This has all the functionality of a `pyfaidx.Fasta` object, 
 see the [documentation](https://github.com/mdshw5/pyfaidx) for more examples on how to use this.
 
 ## Known issues
@@ -593,15 +607,13 @@ When contributing a PR, please use the [develop](https://github.com/vanheeringen
 1. Fork & download this repo. 
 2. `cd` into your local repo. 
 3. `git checkout develop`
-4. `conda env create python=3.6 -f environment.yaml`
+4. `conda env create -f environment.yaml`
 5. `conda activate genomepy`
-6. `python setup.py develop`
-7. `python setup.py build`
+6. `pip install -e .`
 8. `git checkout -b` your_develop_branch
 
 The command line and python imports will now use the code in your local repo. 
-To test your changes locally, run the following command:
-`pytest -vv --disable-pytest-warnings`
+To test your changes locally, run the following command: `pytest -vvv`
 
 ## Contributors
 
diff --git a/docs/content/about.rst b/docs/content/about.rst
index 17151e26..d73494df 100644
--- a/docs/content/about.rst
+++ b/docs/content/about.rst
@@ -7,7 +7,7 @@ About
    :end-line: 14
 
 .. mdinclude:: ../../README.md
-   :start-line: 601
+   :start-line: 617
 
 ..
    note: start- and end-line are 0-indexed.
diff --git a/docs/content/command_line.rst b/docs/content/command_line.rst
index b55383c8..3cbbf340 100644
--- a/docs/content/command_line.rst
+++ b/docs/content/command_line.rst
@@ -3,8 +3,8 @@ Command line documentation
 ==========================
 
 .. mdinclude:: ../../README.md
-   :start-line: 82
-   :end-line: 486
+   :start-line: 86
+   :end-line: 504
 
 ..
    note: start- and end-line are 0-indexed.
diff --git a/docs/content/help_faq.rst b/docs/content/help_faq.rst
index 9d1451e4..a2563f0c 100644
--- a/docs/content/help_faq.rst
+++ b/docs/content/help_faq.rst
@@ -3,5 +3,5 @@ Frequently Asked Questions
 ==========================
 
 .. mdinclude:: ../../README.md
-   :start-line: 531
-   :end-line: 571
+   :start-line: 550
+   :end-line: 595
diff --git a/docs/content/installation.rst b/docs/content/installation.rst
index d7655bff..354856b5 100644
--- a/docs/content/installation.rst
+++ b/docs/content/installation.rst
@@ -3,8 +3,8 @@ Installation
 ============
 
 .. mdinclude:: ../../README.md
-   :start-line: 45
-   :end-line: 81
+   :start-line: 43
+   :end-line: 85
 
 ..
    note: start- and end-line are 0-indexed.
diff --git a/genomepy/cli.py b/genomepy/cli.py
index 2c62e172..80bc16a0 100755
--- a/genomepy/cli.py
+++ b/genomepy/cli.py
@@ -396,16 +396,17 @@ def terminal_subheader(_):
 @click.option("-s", "--size", is_flag=True, help="show absolute genome size")
 def search(term, provider=None, size=False):
     """
-    Search for genomes that contain TERM in their name, description
-    accession (must start with GCA_ or GCF_) or (matching) taxonomy.
-    Search is case-insensitive.
+    Search for genomes that contain TERM in their name, description,
+    accession (must start with GCA_ or GCF_) or taxonomy (start).
+
+    Search is case-insensitive, name/description search accepts multiple terms and regex.
 
     Returns the metadata of each found genome, including the availability of a gene annotation.
     For UCSC, up to 4 gene annotation styles are available:
     "ncbiRefSeq", "refGene", "ensGene", "knownGene" (respectively).
     Each with different naming schemes.
     """
-    term = "_".join(term)
+    term = " ".join(term)
     no_genomes = True
     for row in genomepy.search(term, provider, size):
         if no_genomes:
diff --git a/genomepy/providers/__init__.py b/genomepy/providers/__init__.py
index 2267e23d..509c94e1 100644
--- a/genomepy/providers/__init__.py
+++ b/genomepy/providers/__init__.py
@@ -12,7 +12,7 @@
 from genomepy.providers.ncbi import NcbiProvider, download_assembly_report
 from genomepy.providers.ucsc import UcscProvider
 from genomepy.providers.url import UrlProvider
-from genomepy.utils import get_genomes_dir, safe
+from genomepy.utils import get_genomes_dir
 
 __all__ = [
     "Provider",
@@ -106,18 +106,18 @@ def online_providers(provider: str = None):
             logger.warning(str(e))
 
 
-def search(term, provider: str = None, size=False):
+def search(term: str or int, provider: str = None, size=False):
     """
     Search for a genome.
 
     If provider is specified, search only that specific provider, else
     search all providers. Both the name and description are used for the
-    search. Search term is case-insensitive.
+    search. Search term is case-insensitive and can contain regex.
 
     Parameters
     ----------
-    term : str
-        Search term, case-insensitive.
+    term : str, int
+        Search term, case-insensitive, allows regex.
     provider : str , optional
         Only search the specified provider (faster).
     size : bool, optional
@@ -128,7 +128,6 @@ def search(term, provider: str = None, size=False):
     list
         genome name, provider and metadata
     """
-    term = safe(str(term))
     for p in online_providers(provider):
         for row in p.search(term, size):
             ret = list(row[:1]) + [p.name] + list(row[1:])
diff --git a/genomepy/providers/base.py b/genomepy/providers/base.py
index b0dd4493..5baf09f3 100644
--- a/genomepy/providers/base.py
+++ b/genomepy/providers/base.py
@@ -1,11 +1,12 @@
 """BaseProvider class, the parent of the provider classes"""
 import gzip
 import os
+import re
 import shutil
 import subprocess as sp
 import time
 from tempfile import TemporaryDirectory, mkdtemp
-from typing import Iterator, List, Union
+from typing import Iterator, List
 from urllib.request import urlopen
 
 import pandas as pd
@@ -16,7 +17,7 @@
 from genomepy.exceptions import GenomeDownloadError
 from genomepy.files import extract_archive, get_file_info, update_readme
 from genomepy.online import download_file
-from genomepy.utils import get_genomes_dir, get_localname, lower, mkdir_p, rm_rf, safe
+from genomepy.utils import get_genomes_dir, get_localname, mkdir_p, rm_rf, safe
 
 
 class BaseProvider:
@@ -311,10 +312,14 @@ def download_annotation(self, name, genomes_dir=None, localname=None, **kwargs):
 
     def _search_text(self, term: str) -> Iterator[str]:
         """check if search term is found in the provider's genome name or description field(s)"""
+        # multiple search terms: order doesn't matter
+        if " " in term:
+            term = "".join([f"(?=.*{t})" for t in term.split()])
+
+        pattern = re.compile(term, re.I)  # case insensitive
         for name, metadata in self.genomes.items():
-            if term in lower(name) or any(
-                [term in lower(metadata[f]) for f in self.description_fields]
-            ):
+            texts = [name] + [str(metadata[f]) for f in self.description_fields]
+            if any(pattern.search(t) for t in texts):
                 yield name
 
     def _search_accession(self, term: str) -> Iterator[str]:
@@ -322,16 +327,18 @@ def _search_accession(self, term: str) -> Iterator[str]:
         # cut off prefix (GCA_/GCF_) and suffix (version numbers, e.g. '.3')
         term = term[4:].split(".")[0]
         for name, metadata in self.genomes.items():
-            if any([term in str(metadata[f]) for f in self.accession_fields]):
+            if any(term in str(metadata[f]) for f in self.accession_fields):
                 yield name
 
     def _search_taxonomy(self, term: str) -> Iterator[str]:
-        """check if search term matches to any of the provider's taxonomy field(s)"""
+        """check if search term is the start of the provider's taxonomy field(s)"""
         for name, metadata in self.genomes.items():
-            if any([term == lower(metadata[f]) for f in self.taxid_fields]):
+            if any(
+                str(metadata[f]).strip().startswith(term) for f in self.taxid_fields
+            ):
                 yield name
 
-    def search(self, term: Union[str, int], size=False):
+    def search(self, term: str or int, size=False):
         """
         Search for term in genome names, descriptions and taxonomy ID.
 
@@ -344,7 +351,7 @@ def search(self, term: Union[str, int], size=False):
             Can be (part of) an assembly name (e.g. hg38),
             scientific name (Danio rerio) or assembly
             accession (`GCA_000146045`/`GCF_`),
-            or an exact taxonomy id (7227).
+            or a taxonomy id (7227).
         size : bool, optional
             Show absolute genome size.
 
@@ -352,13 +359,14 @@ def search(self, term: Union[str, int], size=False):
         ------
         tuples with name and metadata
         """
-        term = lower(term)
+        term = str(term).strip()
 
-        search_function = self._search_text
-        if term.startswith(("gca_", "gcf_")):
+        if term.lower().startswith(("gca_", "gcf_")):
             search_function = self._search_accession
-        if term.isdigit():
+        elif term.isdigit():
             search_function = self._search_taxonomy
+        else:
+            search_function = self._search_text
 
         for name in search_function(term):
             yield self._genome_info_tuple(name, size)
diff --git a/tests/test_06_provider_base.py b/tests/test_06_provider_base.py
index 997ed455..084b6dc3 100644
--- a/tests/test_06_provider_base.py
+++ b/tests/test_06_provider_base.py
@@ -162,7 +162,7 @@ def test_head_annotation(ncbi, caplog, capsys):
 
 
 def test__search_text(ucsc):
-    term = genomepy.utils.lower("Ailuropoda melanoleuca")
+    term = "Ailuropoda melanoleuca"
     assert list(ucsc._search_text("not_in_description")) == []
     assert next(ucsc._search_text(term)) == "ailMel1"
 

From 338b7189db668cd03dda89e2f668e767176146a7 Mon Sep 17 00:00:00 2001
From: siebrenf <siebrenf@gmail.com>
Date: Mon, 1 Aug 2022 14:15:12 +0200
Subject: [PATCH 6/9] publication authors & order everywhere

---
 README.md    | 5 +++--
 docs/conf.py | 4 ++--
 2 files changed, 5 insertions(+), 4 deletions(-)

diff --git a/README.md b/README.md
index e0f49e76..b7ceb1db 100644
--- a/README.md
+++ b/README.md
@@ -3,7 +3,7 @@
 [![bioconda-badge](https://img.shields.io/badge/install%20with-bioconda-brightgreen.svg?style=flat)](http://bioconda.github.io)
 [![Anaconda-Server Badge](https://anaconda.org/bioconda/genomepy/badges/downloads.svg)](https://anaconda.org/bioconda/genomepy)
 [![PyPI version](https://badge.fury.io/py/genomepy.svg)](https://badge.fury.io/py/genomepy)
-<!--- [![star this repo](https://githubbadges.com/star.svg?user=vanheeringen-lab&repo=genomepy&style=flat)](https://github.com/vanheeringen-lab/genomepy) -->
+[![GitHub stars](https://badgen.net/github/stars/vanheeringen-lab/genomepy)](https://GitHub.com/vanheeringen-lab/genomepy/stargazers/)
 
 [![Build Status](https://app.travis-ci.com/vanheeringen-lab/genomepy.svg?branch=master)](https://app.travis-ci.com/github/vanheeringen-lab/genomepy/branches)
 [![Maintainability](https://api.codeclimate.com/v1/badges/c4476820f1d21a3e0569/maintainability)](https://codeclimate.com/github/vanheeringen-lab/genomepy/maintainability)
@@ -618,8 +618,9 @@ To test your changes locally, run the following command: `pytest -vvv`
 ## Contributors
 
 - Siebren Frölich - [@siebrenf](https://github.com/siebrenf)
-- Simon van Heeringen - [@simonvh](https://github.com/simonvh)
 - Maarten van der Sande - [@Maarten-vd-Sande](https://github.com/Maarten-vd-Sande)
+- Tilman Schäfers [@tilschaef](https://github.com/tilschaef)
+- Simon van Heeringen - [@simonvh](https://github.com/simonvh)
 - Dohoon Lee - [@dohlee](https://github.com/dohlee)
 - Jie Zhu - [@alienzj](https://github.com/alienzj)
 
diff --git a/docs/conf.py b/docs/conf.py
index 84c502f7..9acbeec7 100644
--- a/docs/conf.py
+++ b/docs/conf.py
@@ -18,8 +18,8 @@
 # -- Project information -----------------------------------------------------
 
 project = 'genomepy'
-copyright = 'Simon van Heeringen, Siebren Frölich, Maarten van der Sande'
-author = 'Simon van Heeringen, Siebren Frölich, Maarten van der Sande'
+copyright = 'Siebren Frölich, Maarten van der Sande, Tilman Schäfers and Simon van Heeringen'
+author = 'Siebren Frölich, Maarten van der Sande, Tilman Schäfers and Simon van Heeringen'
 
 
 # -- General configuration ---------------------------------------------------

From 252c1a4b0e25d50a66a2bbd8ce9bc8452251a578 Mon Sep 17 00:00:00 2001
From: siebrenf <siebrenf@gmail.com>
Date: Mon, 1 Aug 2022 14:25:02 +0200
Subject: [PATCH 7/9] text flow

---
 README.md | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/README.md b/README.md
index b7ceb1db..426c92f0 100644
--- a/README.md
+++ b/README.md
@@ -351,17 +351,17 @@ $ genomepy  install hg38 -p UCSC --annotation
 All selected options are stored in a `README.txt`. 
 This includes the original name, download location and other genomepy operations (such as regex filtering and time).
 
-###### Additional providers
+#### Other providers (any URL/local files)
 
 To facilitate the downloading of genomes not supported by either NCBI, UCSC, or Ensembl, genomes 
-can also be downloaded directly from an url, by specifying `URL` as the provider:
+can also be downloaded directly from any URL, by specifying `URL` as the provider:
 
 ```bash
 $ genomepy install -p url https://research.nhgri.nih.gov/hydra/download/assembly/\Hm105_Dovetail_Assembly_1.0.fa.gz
 ```
 
-This installs the genome under the filename of the link, but can be changed with the `--localname` option.
 Similarly, if you have a local fasta file, you can install this using the filepath and specifying `Local` as the provider.
+This installs the genome under the filename of the URL/filepath, but can be changed with the `--localname` option.
 
 If you add the `--annotation` flag, genomepy will search the (remote) directory for an annotation file as well.
 Should this fail, you can also add a URL to the annotation with `--URL-to-annotation` with the `URL` provider, 

From 7cae2270e00049b8ad5ec4007e16e7dc0efb9841 Mon Sep 17 00:00:00 2001
From: siebrenf <siebrenf@gmail.com>
Date: Mon, 1 Aug 2022 14:49:43 +0200
Subject: [PATCH 8/9] release 0.14

---
 CHANGELOG.md              | 3 +++
 docs/release_checklist.md | 1 +
 genomepy/__about__.py     | 4 ++--
 3 files changed, 6 insertions(+), 2 deletions(-)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index c680fbe6..5223164e 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -6,6 +6,8 @@ The format is based on [Keep a Changelog](http://keepachangelog.com/en/1.0.0/).
 
 ## [Unreleased]
 
+## [0.14.0] - 2022-08-01
+
 ### Added
 - now using `filelock` for improved thread safety
 - now checking if every API/FTP/HTTP(S) is accessible before proceeding
@@ -429,6 +431,7 @@ The format is based on [Keep a Changelog](http://keepachangelog.com/en/1.0.0/).
 - Added `-r` and `--match/--no-match` option to select sequences by regex.
 
 [Unreleased]: https://github.com/vanheeringen-lab/genomepy/compare/master...develop
+[0.14.0]: https://github.com/vanheeringen-lab/genomepy/compare/0.13.1...0.14.0
 [0.13.1]: https://github.com/vanheeringen-lab/genomepy/compare/0.13.0...0.13.1
 [0.13.0]: https://github.com/vanheeringen-lab/genomepy/compare/0.12.0...0.13.0
 [0.12.0]: https://github.com/vanheeringen-lab/genomepy/compare/0.11.1...0.12.0
diff --git a/docs/release_checklist.md b/docs/release_checklist.md
index 72e86343..77f311d0 100644
--- a/docs/release_checklist.md
+++ b/docs/release_checklist.md
@@ -5,6 +5,7 @@
 1. Make sure all tests pass.
 
     ```shell
+    mamba env update -f environment.yml
     pytest -vvv
     ```
 
diff --git a/genomepy/__about__.py b/genomepy/__about__.py
index 407f3727..092f21bb 100644
--- a/genomepy/__about__.py
+++ b/genomepy/__about__.py
@@ -1,3 +1,3 @@
 """Metadata"""
-__version__ = "0.13.1"
-__author__ = "Simon van Heeringen, Siebren Frölich, Maarten van der Sande"
+__version__ = "0.14.0"
+__author__ = "Siebren Frölich, Maarten van der Sande, Tilman Schäfers and Simon van Heeringen"

From df35379ad4954ea889407b9ce6bffbc3dc3de6b3 Mon Sep 17 00:00:00 2001
From: siebrenf <siebrenf@gmail.com>
Date: Mon, 1 Aug 2022 15:27:34 +0200
Subject: [PATCH 9/9] fix current publishing issues

---
 docs/release_checklist.md | 1 +
 environment.yml           | 2 ++
 genomepy/__about__.py     | 4 +++-
 genomepy/functions.py     | 5 ++++-
 4 files changed, 10 insertions(+), 2 deletions(-)

diff --git a/docs/release_checklist.md b/docs/release_checklist.md
index 77f311d0..774d1c42 100644
--- a/docs/release_checklist.md
+++ b/docs/release_checklist.md
@@ -53,6 +53,7 @@
     genomepy install -af -p ncbi ASM2732v1
     genomepy install -af -p url -l url_test https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/027/325/GCF_000027325.1_ASM2732v1/GCF_000027325.1_ASM2732v1_genomic.fna.gz --URL-to-annotation https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/027/325/GCF_000027325.1_ASM2732v1/GCF_000027325.1_ASM2732v1_genomic.gff.gz
     genomepy install -af -p local -l local_test ~/.local/share/genomes/TAIR10/TAIR10.fa --Local-path-to-annotation ~/.local/share/genomes/TAIR10/TAIR10.annotation.gtf
+    
     ```
 
 6. Finish the release:
diff --git a/environment.yml b/environment.yml
index c2878459..9207f32a 100644
--- a/environment.yml
+++ b/environment.yml
@@ -41,6 +41,8 @@ dependencies:
 
   # Distribution
   - python-build
+  - twine ==3.3.0
+  - keyring ==22.3.0
 
   # Testing
   - autoflake ==1.4
diff --git a/genomepy/__about__.py b/genomepy/__about__.py
index 092f21bb..1ca9df95 100644
--- a/genomepy/__about__.py
+++ b/genomepy/__about__.py
@@ -1,3 +1,5 @@
 """Metadata"""
 __version__ = "0.14.0"
-__author__ = "Siebren Frölich, Maarten van der Sande, Tilman Schäfers and Simon van Heeringen"
+__author__ = (
+    "Siebren Frölich, Maarten van der Sande, Tilman Schäfers and Simon van Heeringen"
+)
diff --git a/genomepy/functions.py b/genomepy/functions.py
index 48785cbd..ab123c11 100644
--- a/genomepy/functions.py
+++ b/genomepy/functions.py
@@ -1,6 +1,7 @@
 """Module-level functions"""
 import os
 import re
+import sys
 from tempfile import mkdtemp
 from typing import Optional
 
@@ -335,7 +336,9 @@ def _lazy_provider_selection(name, provider=None):
         if p.name == "Local" and os.path.exists(cleanpath(name)):
             return p
 
-    raise GenomeDownloadError(f"{name} not found on {', '.join(providers)}.")
+    if len(providers):
+        raise GenomeDownloadError(f"{name} not found on {', '.join(providers)}.")
+    sys.exit(0)
 
 
 def _provider_selection(name, localname, genomes_dir, provider=None):