aklujkar_09_genome_798208.pdf.txt

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><html xmlns="http://www.w3.org/1999/xhtml">
<head>
<title>1471-2180-9-109.fm</title>
<meta name="Author" content="Ezhilan"/>
<meta name="Creator" content="FrameMaker 7.1"/>
<meta name="Producer" content="Acrobat Distiller 7.0 (Windows)"/>
<meta name="CreationDate" content=""/>
</head>
<body>
<pre>
BMC Microbiology

BioMed Central

Open Access

Research article

The genome sequence of Geobacter metallireducens: features of
metabolism, physiology and regulation common and dissimilar to
Geobacter sulfurreducens
Muktak Aklujkar*1, Julia Krushkal2, Genevieve DiBartolo3, Alla Lapidus3,
Miriam L Land4 and Derek R Lovley1
Address: 1Department of Microbiology, University of Massachusetts Amherst, Amherst, MA, USA, 2Department of Preventive Medicine and Center
of Genomics and Bioinformatics, University of Tennessee Health Science Center, University of Tennessee, Memphis, TN, USA, 3Department of
Energy, Joint Genome Institute, Walnut Creek, CA, USA and 4Oak Ridge National Laboratory, Oak Ridge, TN, USA
Email: Muktak Aklujkar* - muktak@microbio.umass.edu; Julia Krushkal - jkrushka@utmem.edu;
Genevieve DiBartolo - gen.dibartolo@gmail.com; Alla Lapidus - ALapidus@lbl.gov; Miriam L Land - landml@ornl.gov;
Derek R Lovley - dlovley@microbio.umass.edu
* Corresponding author

Published: 27 May 2009
BMC Microbiology 2009, 9:109

doi:10.1186/1471-2180-9-109

Received: 11 December 2008
Accepted: 27 May 2009

This article is available from: http://www.biomedcentral.com/1471-2180/9/109
© 2009 Aklujkar et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract
Background: The genome sequence of Geobacter metallireducens is the second to be completed
from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter
sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and
differences.
Results: The experimentally observed greater metabolic versatility of G. metallireducens versus G.
sulfurreducens is borne out by the presence of more numerous genes for metabolism of organic
acids including acetate, propionate, and pyruvate. Although G. metallireducens lacks a dicarboxylic
acid transporter, it has acquired a second putative succinate dehydrogenase/fumarate reductase
complex, suggesting that respiration of fumarate was important until recently in its evolutionary
history. Vestiges of the molybdate (ModE) regulon of G. sulfurreducens can be detected in G.
metallireducens, which has lost the global regulatory protein ModE but retained some putative
ModE-binding sites and multiplied certain genes of molybdenum cofactor biosynthesis. Several
enzymes of amino acid metabolism are of different origin in the two species, but significant patterns
of gene organization are conserved. Whereas most Geobacteraceae are predicted to obtain
biosynthetic reducing equivalents from electron transfer pathways via a ferredoxin oxidoreductase,
G. metallireducens can derive them from the oxidative pentose phosphate pathway. In addition to
the evidence of greater metabolic versatility, the G. metallireducens genome is also remarkable for
the abundance of multicopy nucleotide sequences found in intergenic regions and even within
genes.
Conclusion: The genomic evidence suggests that metabolism, physiology and regulation of gene
expression in G. metallireducens may be dramatically different from other Geobacteraceae.

Page 1 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

Background
Geobacter metallireducens is a member of the Geobacteraceae, a family of Fe(III)-respiring Delta-proteobacteria
that are of interest for their role in cycling of carbon and
metals in aquatic sediments and subsurface environments
as well as the bioremediation of organic- and metal-contaminated groundwater and the harvesting of electricity
from complex organic matter [1,2]. G. metallireducens is of
particular interest because it was the first microorganism
found to be capable of a number of novel anaerobic processes including: (1) conservation of energy to support
growth from the oxidation of organic compounds coupled to the reduction of Fe(III) or Mn(IV) [3,4]; (2) conversion of Fe(III) oxide to ultrafine-grained magnetite [3];
(3) anaerobic oxidation of an aromatic hydrocarbon
[5,6]; (4) reduction of U(VI) [7]; (5) use of humic substances as an electron acceptor [8]; (6) chemotaxis toward
metals [9]; (7) complete oxidation of organic compounds
to carbon dioxide with an electrode serving as the sole
electron acceptor ([10]; and (8) use of a poised electrode
as a direct electron donor [11]. Although the complete
genome sequence of the closely related Geobacter sulfurreducens is available [12] and can provide insights into some
of the common metabolic features of Geobacter species, G.
metallireducens and G. sulfurreducens are significantly different in many aspects of their physiology. G. sulfurreducens is known to use only four carbon sources: acetate,
formate, lactate (poorly) and pyruvate (only with hydrogen as electron donor), whereas G. metallireducens uses
acetate, benzaldehyde, benzoate, benzylalcohol, butanol,
butyrate, p-cresol, ethanol, p-hydroxybenzaldehyde, phydroxybenzoate, p-hydroxybenzylalcohol, isobutyrate,
isovalerate, phenol, propionate, propanol, pyruvate, toluene and valerate [2].
Therefore, in order to gain broader insight into the physiological diversity of Geobacter species, the genome of G.
metallireducens was sequenced and compared to that of
Geobacter sulfurreducens [12]. Both genome annotations
were manually curated with the addition, removal and
adjustment of hundreds of protein-coding genes and
other features. Phylogenetic analyses were conducted to
validate the findings, including homologs from the finished and unfinished genome sequences of more distantly
related Geobacteraceae. This paper presents insights into
the conserved and unique features of two Geobacter species, particularly the metabolic versatility of G. metallireducens and the numerous families of multicopy nucleotide
sequences in its genome, which suggest that regulation of
gene expression is very different in these two species.

Results and Discussion
Contents of the two genomes
The automated annotation of the G. metallireducens
genome identified 3518 protein-coding genes on the

http://www.biomedcentral.com/1471-2180/9/109

chromosome of 3997420 bp and 13 genes on the plasmid
(designated pMET1) of 13762 bp. Manual curation added
59 protein-coding genes plus 56 pseudogenes to the chromosome and 4 genes to the plasmid. Ten of the chromosomal genes were reannotated as pseudogenes and
another 22 were removed from the annotation. In addition to the 58 RNA-coding genes in the automated annotation, manual curation identified 479 conserved
nucleotide sequence features. Likewise, to the 3446 protein-coding genes in the automated annotation of the G.
sulfurreducens genome [12], manual curation added 142
protein-coding genes and 19 pseudogenes. Five genes
were reannotated as pseudogenes and 103 genes were
removed from the annotation. In addition to the 55 RNAcoding genes in the automated annotation, manual curation identified 462 conserved nucleotide sequence features. Of the 3629 protein-coding genes and pseudogenes
in G. metallireducens, 2403 (66.2%) had one or more fulllength homologs in G. sulfurreducens.
The nucleotide composition of the 3563 intact proteincoding genes of G. metallireducens was determined in
order to identify some of those that were very recently
acquired. The average G+C content of the protein-coding
genes was 59.5%, with a standard deviation of 5.9%. Only
three genes had a G+C content more than two standard
deviations above the mean (> 71.2%), but 146 genes had
a G+C content more than two standard deviations below
the mean (< 47.7%), most of which lack homologs in G.
sulfurreducens and may be recent acquisitions (Additional
file 1: Table S1). Clusters of such genes (shaded in Additional file 1: Table S1) were often interrupted or flanked
by transposons with higher G+C content. The functions of
most of these genes cannot be assigned at present, but 23
of them are predicted to act in cell wall biogenesis.
Plasmid pMET1 of G. metallireducens consists of a series of
six predicted transcriptional units on one strand, tentatively attributed to the mobilization (Gmet_A3575Gmet_A3574-Gmet_A3573-Gmet_A3572-Gmet_A3643),
entry exclusion (Gmet_A3571), addiction (Gmet_A3570Gmet_A3579-Gmet_A3642), partition (Gmet_A3568Gmet_A3641), transposition (Gmet_A3567), and replication (Gmet_A3566-Gmet_A3565) functions of the plasmid, and one operon on the opposite strand, comprised
of three genes of unknown function (Gmet_A3576Gmet_A3577-Gmet_A3644). The predicted origin of replication, located 3' of the repA gene (Gmet_A3565),
includes four pairs of iterons and a set of six hairpins, suggesting that pMET1 replicates by a rolling-circle mechanism, although it is significantly larger than most such
plasmids [13]. Among the fifteen other nucleotide
sequence features identified on the plasmid during manual curation was a palindromic putative autoregulatory
site (TTTGTTATACACGTATAACAAA) located 5' of the

Page 2 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

http://www.biomedcentral.com/1471-2180/9/109

addiction module. Other than the potential toxicity of the
addiction module, the impact of pMET1 on the physiology of G. metallireducens is unknown.
Metabolism of acetate and other carbon sources
Acetate is expected to be the key electron donor supporting Fe(III) reduction in aquatic sediments and subsurface
environments [14], and Geobacter species quickly become
the predominant bacterial species when acetate is injected
into subsurface environments to promote in situ bioremedation of uranium-contaminated groundwater [15,16].
Surprisingly, the initial activation of acetate by ligation
with coenzyme A (CoA) in G. sulfurreducens occurs by two
reversible pathways [17] (Figure 1), indicating that acetate
may be inefficiently utilized at low concentrations. These
two pathways are also present in G. metallireducens, along
with a third, irreversible reaction that may permit efficient
activation of acetate at low concentrations. The first pathway of acetate activation (Figure 1a) occurs through either
of two succinyl:acetate CoA-transferases that can convert
succinyl-CoA to succinate during oxidation of acetate by
the tricarboxylic acid (TCA) cycle pathway, in the same
capacity as succinyl-CoA synthetase but conserving energy
in the form of acetyl-CoA rather than GTP or ATP [17].
Microarray data from both species suggest that expression
of one succinyl:acetate CoA-transferase isoenzyme
(Gmet_1730 = GSU0174) is constant and expression of
the other (Gmet_3044 = GSU0490) is induced during acetate-fueled growth with electron acceptors other than sol-

(a)

O

2-CH2-C

CoA

+

CH3

succinyl-CoA

(b)

O

-O-C-CH

succinyl:acetate CoA-transferases
Gmet_1730, Gmet_3044

acetate

ATP

(c)

O

O

-C-O-

O

ADP

CH3-C-Oacetate

Three enzymes distantly related to the succinyl:acetate
CoA-transferases
are
encoded
by
Gmet_2054,
Gmet_3294, and Gmet_3304, for which there are no
counterparts in G. sulfurreducens. All three of these proteins closely match the characterized butyryl:4-hydroxybutyrate/vinylacetate CoA-transferases of Clostridium
species [20]. However, their substrate specificities may be
different because the G. metallireducens proteins and the
Clostridium proteins cluster phylogenetically with different CoA-transferases of Geobacter strain FRC-32 and Geobacter bemidjiensis (data not shown). The presence of these

O

O

-O-C-CH

uble Fe(III), such as Fe(III) oxides, nitrate, or fumarate (D.
Holmes, B. Postier, and R. Glaven, personal communications). The second pathway (Figure 1b) consists of two
steps: acetate kinase (Gmet_1034 = GSU2707) converts
acetate to acetyl-phosphate, which may be a global intracellular signal affecting various phosphorylation-dependent signalling systems, as in Escherichia coli [18]; and
phosphotransacetylase (Gmet_1035 = GSU2706) converts acetyl-phosphate to acetyl-CoA [17]. G. metallireducens possesses orthologs of the enzymes of both pathways
characterized in G. sulfurreducens [17], and also has an
acetyl-CoA synthetase (Gmet_2340, 42% identical to the
Bacillus subtilis enzyme [19]) for irreversible activation of
acetate to acetyl-CoA at the expense of two ATP (Figure
1c). Thus, Geobacteraceae such as G. metallireducens may be
better suited to metabolize acetate at the low concentrations naturally found in most soils and sediments.

O

2-CH2

O

+

-C-O-

acetate kinase
Gmet_1034

acetyl-phosphate

O
CH3-C-Oacetate

ATP + CoA

AMP + PPi

CoA

Pi

O
CH3-C

phosphotransacetylase
Gmet_1035

CoA

acetyl-CoA

O
CH3-C

acetyl-CoA synthetase
Gmet_2340

CoA

acetyl-CoA

succinate

CH3-C-O-P-OO-

CH3-C

CoA

acetyl-CoA

Figure 1
Pathways of acetate activation in G. metallireducens
Pathways of acetate activation in G. metallireducens. (a) The succinyl:acetate CoA-transferase reaction. (b) The acetate
kinase and phosphotransacetylase reactions. (c) The acetyl-CoA synthetase reaction.

Page 3 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

CoA-transferases indicates that G. metallireducens has
evolved energy-efficient activation steps for some unidentified organic acid substrates that G. sulfurreducens cannot
utilize.
Numerous other enzymes of acyl-CoA metabolism are
predicted from the genome of G. metalllireducens but not
that of G. sulfurreducens (Additional file 2: Table S2),
including six gene clusters, three of which have been
linked to degradation of aromatic compounds that G. metallireducens can utilize [6,21-23] but G. sulfurreducens cannot [24]. All seven acyl-CoA synthetases of G.
sulfurreducens have orthologs in G. metallireducens, but the
latter also possesses acetyl-CoA synthetase, benzoate CoAligase (experimentally validated [23]), and seven other
acyl-CoA synthetases of unknown substrate specificity.
The G. metallireducens genome also includes eleven acylCoA dehydrogenases, three of which are specific for benzylsuccinyl-CoA (69% identical to the Thauera aromatica
enzyme [25]), glutaryl-CoA (experimentally validated
[26]) and isovaleryl-CoA (69% identical to the Solanum
tuberosum mitochondrial enzyme [27]), whereas none can
be identified in G. sulfurreducens. G. metallireducens also
has nine pairs of electron transfer flavoprotein genes
(seven of which are adjacent to genes encoding iron-sulfur
cluster-binding proteins) that are hypothesized to connect
acyl-CoA dehydrogenases to the respiratory chain,
whereas G. sulfurreducens has only one. None of the seventeen enoyl-CoA hydratases of G. metallireducens is an
ortholog of GSU1377, the sole enoyl-CoA hydratase of G.
sulfurreducens. G. metallireducens also possesses eleven
acyl-CoA thioesterases, of which G. sulfurreducens has
orthologs of five plus the unique thioesterase GSU0196.
Of the ten acyl-CoA thiolases of G. metallireducens, only
Gmet_0144 has an ortholog (GSU3313) in G. sulfurreducens. BLAST searches and phylogenetic analyses demonstrated that several of these enzymes of acyl-CoA
metabolism have close relatives in G. bemidjiensis, Geobacter FRC-32, Geobacter lovleyi and Geobacter uraniireducens, indicating that their absence from G. sulfurreducens is
due to gene loss, and that this apparent metabolic versatility is largely the result of expansion of enzyme families
within the genus Geobacter (data not shown). The ability
of G. metallireducens and other Geobacteraceae to utilize
carbon sources that G. sulfurreducens cannot utilize may be
due to stepwise breakdown of multicarbon organic acids
to simpler compounds by these enzymes.
Growth of G. metallireducens on butyrate may be attributed to reversible phosphorylation by either of two
butyrate kinases (Gmet_2106 and Gmet_2128), followed
by reversible CoA-ligation by phosphotransbutyrylase
(Gmet_2098), a pathway not present in G. sulfurreducens,
which cannot grow on butyrate [24]. These gene products
are 42–50% identical to the enzymes characterized in

http://www.biomedcentral.com/1471-2180/9/109

Clostridium beijerinckii and Clostridium acetobutylicum
[28,29].
An enzyme very similar to succinyl:acetate CoA-transferase is encoded by Gmet_1125 within the same operon
as methylisocitrate lyase (Gmet_1122), 2-methylcitrate
dehydratase (Gmet_1123), and a citrate synthase-related
protein hypothesized to be 2-methylcitrate synthase
(Gmet_1124) [30] (Figure 2a), all of which are absent in
G. sulfurreducens. This arrangement of genes, along with
the ability of G. metallireducens to utilize propionate as an
electron donor [31] whereas G. sulfurreducens cannot [24],
suggests that the Gmet_1125 protein could be a succinyl:propionate CoA-transferase that, together with the
other three products of the operon, would convert propionate (via propionyl-CoA) and oxaloacetate to pyruvate
and succinate (Figure 2b). Upon oxidation of succinate to
oxaloacetate through the TCA cycle and oxidative decarboxylation of pyruvate to acetyl-CoA, the pathway would
be equivalent to the breakdown of propionate into six
electrons, one molecule of carbon dioxide, and acetate,
followed by the succinyl:acetate CoA-transferase reaction
(Figure 2b). In a phylogenetic tree, the hypothetical succinyl:propionate CoA-transferase Gmet_1125 and gene
Geob_0513 of Geobacter FRC-32, which is also capable of
growth with propionate as the sole electron donor and
carbon source (M. Aklujkar, unpublished), form a branch
adjacent to succinyl:acetate CoA-transferases of the genus
Geobacter (data not shown). In a similar manner, the
hypothetical 2-methylcitrate synthase Gmet_1124 and
gene Geob_0514 of Geobacter FRC-32 form a branch adjacent to citrate synthases of Geobacter species (data not
shown), consistent with the notion that these two enzyme
families could have recently evolved new members capable of converting propionate via propionyl-CoA to 2methylcitrate.
Gmet_0149 (GSU3448) is a homolog of acetate kinase
that does not contribute sufficient acetate kinase activity
to sustain growth of G. sulfurreducens [17] and has a closer
BLAST hit to propionate kinase of E. coli (40% identical
sequence) than to acetate kinase of E. coli. Although it
does not cluster phylogenetically with either of the E. coli
enzymes, its divergence from acetate kinase (Gmet_1034
= GSU2707) is older than the last common ancestor of the
Geobacteraceae (data not shown). This conserved gene
product remains to be characterized as a propionate
kinase or something else.
The proposed pathway for growth of G. metallireducens on
propionate (Figure 2) is contingent upon its experimentally established ability to grow on pyruvate [31]. G. sulfurreducens cannot utilize pyruvate as the carbon source
unless hydrogen is provided as an electron donor [17].
Oxidation of acetyl-CoA derived from pyruvate in G. sul-

Page 4 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

(a)

Gmet_1121

http://www.biomedcentral.com/1471-2180/9/109

Gmet_1122

Gmet_1123

(b)

O

O

-O-C-CH

2-CH2-C

Gmet_1125

Gmet_1126

2-methylcitrate
dehydratase

transcriptional methylisocitrate
regulator
lyase

Gmet_1124

[2-methyl]citrate
synthase

[succinyl:propionate]
CoA-transferase

membrane
protein

O

O
CoA

+

CH3-CH2-C-Opropionate

succinyl-CoA

O

-O-C-CH

succinyl:propionate CoA-transferase?
Gmet_1125

O

+

2-CH2-C-O

CH3-CH2-C

succinate

CoA

propionyl-CoA
O

FAD

H2O

-O-C-CH

OO

NAD+

NADH

2-C-C-O

oxaloacetate

-

O
-O-C-CH

malate dehydrogenase
Gmet_1360

HO O

O

H2O
-

O

O

HO O

-O-C-CH

2-C-C-O

-

CH

fumarate hydratase
Gmet_2570

malate

CoA

-O-C-CH=CH-C-O -

2-C-C-O

OO
2-C-C-O

oxaloacetate

FADH2

O

+

2-methylcitrate
synthase?
Gmet_1124

succinate dehydrogenases
Gmet_2397-Gmet_2396-Gmet_2395
or Gmet_0308-Gmet_0309-Gmet_0310

-O-C-CH

CH3 C-O-

fumarate

O
2-methylcitrate
H2O
O

O

-O-C-CH

+

CH3-C

NADH or
reduced ferredoxin

NAD+

or
ferredoxin

CoA

acetyl-CoA

-

succinate

CO2
O

2-CH2-C-O

2-methylcitrate
dehydratase
Gmet_1123

+

O

OO

pyruvate

O

-O-C-CH

2-CH-C-O

-

C-OH

CH3-C-C-Opyruvate dehydrogenases and
ferredoxin/flavodoxin oxidoreductases

H2O

methylisocitrate lyase
Gmet_1122

CH3 C-OO
methylisocitrate

Figure 2 G. metallireducens on propionate
Growth of
Growth of G. metallireducens on propionate. (a) The gene cluster predicted to encode enzymes of propionate metabolism. (b) The proposed pathway of propionate metabolism.
furreducens may be prevented by a strict requirement for
the succinyl:acetate CoA-transferase reaction (thermodynamically inhibited when acetyl-CoA exceeds acetate) to
complete the TCA cycle in the absence of detectable activity of succinyl-CoA synthetase (GSU1058-GSU1059)
[17]. With three sets of succinyl-CoA synthetase genes
(Gmet_0729-Gmet_0730, Gmet_2068-Gmet_2069, and
Gmet_2260-Gmet_2261), G. metallireducens may produce
enough activity to complete the TCA cycle.
G. sulfurreducens and G. metallireducens may interconvert
malate and pyruvate through a malate oxidoreductase
fused to a phosphotransacetylase-like putative regulatory
domain (maeB; Gmet_1637 = GSU1700), which is 51%

identical to the NADP+-dependent malic enzyme of E. coli
[32]. G. sulfurreducens has an additional malate oxidoreductase without this fusion (mleA; GSU2308) that is 53%
identical to an NAD+-dependent malic enzyme of B. subtilis [33], but G. metallireducens does not.
G. metallireducens possesses orthologous genes for all
three pathways that activate pyruvate or oxaloacetate to
phosphoenolpyruvate in G. sulfurreducens (Figure 3a):
phosphoenolpyruvate
synthase
(Gmet_0770
=
GSU0803), pyruvate phosphate dikinase (Gmet_2940 =
GSU0580) and GTP-dependent phosphoenolpyruvate
carboxykinase Gmet_2638 = GSU3385) [17]. It also
encodes a homolog of the ATP-dependent phosphoePage 5 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

http://www.biomedcentral.com/1471-2180/9/109

nolpyruvate carboxykinase of E. coli (Gmet_3169, 48%
identical) that has no homolog in G. sulfurreducens. In the
catabolic direction, in addition to pyruvate kinase
(Gmet_0122 = GSU3331) that converts phosphoenolpyruvate to pyruvate plus ATP, G. metallireducens has a
homolog of E. coli phosphoenolpyruvate carboxylase
(Gmet_0304, 30% identical, also found in Geobacter FRC32) that may convert phosphoenolpyruvate to oxaloacetate irreversibly (Figure 3b) and contribute to the

(a)

observed futile cycling of pyruvate/oxaloacetate/phosphoenolpyruvate [34] if not tightly regulated. Thus, control of the fate of pyruvate appears to be more complex in
G. metallireducens than in G. sulfurreducens.
Evidence of recent fumarate respiration in G.
metallireducens
The succinate dehydrogenase complex of G. sulfurreducens
also functions as a respiratory fumarate reductase, possi-

O

O

O

-O-P-O -

-O-P-O -

-O-P-O -

OO
CH2

OO

=C-C-O-

CH2=C-C-O-

phosphoenolpyruvate

phosphoenolpyruvate

phosphoenolpyruvate

AMP + Pi
phosphoenolpyruvate
synthase
Gmet_0770

OO

CH2=C-C-O-

AMP + PPi

ATP + Pi

OO

OO

CH3-C-C-O-

pyruvate

ATP

ADP + Pi

O

pyruvate carboxylase
Gmet_0816

GTP/ATP

OO
2-C-C-O

oxaloacetate

O

-O-P-O -

O
-O-C-CH

CH3-C-C-O-

pyruvate

(b)

phosphoenolpyruvate
carboxykinases
Gmet_2638
Gmet_3169

pyruvate phosphate
dikinase
Gmet_2940
ATP + H2O

GDP/ADP + CO2

-O-P-O -

OO

OO

CH2=C-C-O-

CH2=C-C-O-

phosphoenolpyruvate

phosphoenolpyruvate

ADP
pyruvate
kinase
Gmet_0122

CO2
phosphoenolpyruvate
carboxylase
Gmet_0304
Pi

ATP

OO
CH3-C-C-Opyruvate

O
-O-C-CH

OO
2-C-C-O

oxaloacetate

Figure 3futile cycling of pyruvate/oxaloacetate and phosphoenolpyruvate in G. metallireducens
Potential
Potential futile cycling of pyruvate/oxaloacetate and phosphoenolpyruvate in G. metallireducens. (a) Conversion
of pyruvate to phosphoenolpyruvate. (b) Conversion of phosphoenolpyruvate to pyruvate or oxaloacetate.

Page 6 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

http://www.biomedcentral.com/1471-2180/9/109

bly in association with a co-transcribed b-type cytochrome
[35]. G. metallireducens has homologous genes
(Gmet_2397-Gmet_2395 = GSU1176-GSU1178), but is
unable to grow with fumarate as the terminal electron
acceptor unless transformed with a plasmid that expresses
the dicarboxylic acid exchange transporter gene dcuB of G.
sulfurreducens [35], which has homologues in Geobacter
FRC-32, G. bemidjiensis, G. lovleyi, and G. uraniireducens.
Surprisingly, G. metallireducens has acquired another putative succinate dehydrogenase or fumarate reductase complex (Gmet_0308-Gmet_0310), not found in other
Geobacteraceae, by lateral gene transfer from a relative of
the Chlorobiaceae (phylogenetic trees not shown), and
evolved it into a gene cluster that includes enzymes of central metabolism acquired from other sources (Figure 4).
Thus, G. metallireducens may have actually enhanced its
ability to respire fumarate before recently losing the requisite transporter.
Nitrate respiration and loss of the modE regulon from G.
metallireducens
G. metallireducens is able to respire nitrate [4], whereas G.
sulfurreducens cannot [24]. The nitrate reductase activity of
G. metallireducens is attributed to the narGYJI genes (Figure
5a; Gmet_0329-Gmet_0332), which are adjacent to the
narK-1 and narK-2 genes encoding a proton/nitrate symporter and a nitrate/nitrite antiporter (Gmet_0333 and
Gmet_0334, respectively) predicted according to homology with the two halves of narK in Paracoccus pantotrophus
[36]. A second narGYI cluster (Figure 5b; Gmet_1020 to
Gmet_1022) is missing a noncatalytic subunit (narJ), and
its expression has not been detected (B. Postier, personal
communication). The first gene of both operons encodes

(a)

Gmet_2396

flavoprotein
component

Phylogenetic analysis indicates that the moeA and moaA
gene families have repeatedly expanded in various Geobacteraceae (data not shown). G. sulfurreducens has a single
copy of each, but G. metallireducens has three closely
related isoenzymes, of which moeA-1 (Gmet_1038 =
GSU2703, 40% identical to the E. coli protein [39]) and
moaA-1 (Gmet_0301 = GSU3146, 36% identical to the E.
coli protein [40]) occupy a conserved location among
other genes of molybdopterin biosynthesis (Table 1, Figure 6). A possible reason for the expansion in G. metallireducens and other Geobacteraceae is a need to upregulate
molybdopterin biosynthesis for specific processes: moeA-2
and moaA-2 (Gmet_0336-Gmet_0337, 38% and 33%
identity to the E. coli proteins) may support nitrate reduction; moaA-3 (Gmet_2095, 35% identity to E. coli) may
function with nearby gene clusters for catabolism of benzoate [23] and p-cresol [22]; and moeA-3 (Gmet_1804,

Gmet_2395

cyt b
component

(b)

Gmet_2397

a unique diheme c-type cytochrome (Gmet_0328 and
Gmet_1019), suggesting that the nitrate reductase may be
connected to other electron transfer components besides
the menaquinol pool, perhaps operating in reverse as a
nitrite oxidase. The product of the ppcF gene (Gmet_0335)
in the intact nar operon, which is related to a periplasmic
triheme c-type cytochrome involved in Fe(III) reduction
in G. sulfurreducens [37], may permit electron transfer to
the nitrate reductase from extracellular electron donors
such as humic substances [38] or graphite electrodes [11].
The final two genes of the intact nar operon (Gmet_0336Gmet_0337), encode the MoeA and MoaA enzymes
implicated in biosynthesis of bis-(molybdopterin guanine
dinucleotide)-molybdenum, an essential cofactor of the
nitrate reductase.

iron-sulfur
component

Gmet_0304

phosphoenolpyruvate
carboxylase

Gmet_0305

Gmet_0306

succinyl-CoA
succinyl-CoA synthetase
synthetase 2-related protein 1-related protein

Gmet_0307 Gmet_0308

Gmet_0309 Gmet_0310

conserved flavoprotein
protein
component

iron-sulfur
cyt b
component component

Figure 4 of a second fumarate reductase/succinate dehydrogenase by G. metallireducens
Acquisition
Acquisition of a second fumarate reductase/succinate dehydrogenase by G. metallireducens. (a) The ancestral gene
cluster. (b) The gene cluster acquired from a relative of the Chlorobiaceae, located near other acquired genes relevant to central metabolism: an uncharacterized enzyme related to succinyl-CoA synthetase and citrate synthase (Gmet_0305-Gmet_0306)
and phosphoenolpyruvate carboxylase (Gmet_0304). Conserved nucleotide sequences (black stripes) were also identified in
the two regions.

Page 7 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

(a)

http://www.biomedcentral.com/1471-2180/9/109

Gmet_0329

cyt c

(b)

Gmet_0328

narG-1

Gmet_1018 Gmet_1019

nirD cyt c

Gmet_1020

narG-2

Gmet_0332
Gmet_0330 Gmet_0331
Gmet_0333

narY-1

narJ narI-1

narK-1

Gmet_0335
Gmet_0334
Gmet_0336 Gmet_0337

narK-2

ppcF

moeA-2

moaA-2

Gmet_1021 Gmet_1022

narY-2

narI-2

Figure 5
The respiratory nitrate reductase operons
The respiratory nitrate reductase operons. (a) The major (expressed) operon also encodes the nitrate and nitrite transporters (narK-1, narK-2), two c-type cytochromes including ppcF, and two genes of molybdenum cofactor biosynthesis (moeA-2,
moaA-2). (b) The minor operon (expression not detected) also encodes the Rieske iron-sulfur component of nitrite reductase
(nirD) and a c-type cytochrome, but lacks a narJ gene.

37% identity to E. coli) may aid growth on benzoate, during which it is upregulated [21]. G. metallireducens differs
from G. sulfurreducens in other aspects of molybdenum
assimilation as well (Table 1): notably, G. sulfurreducens
possesses a homolog of the moaE gene (GSU2699) encoding the large subunit of molybdopterin synthase, but lacks
homologs of the small subunit gene moaD and the molybdopterin synthase sulfurylase gene moeB, whereas G. metallireducens lacks a moaE homolog but possesses
homologs of moaD
(Gmet_1043) and moeB
(Gmet_1042). Comparison with the genomes of other
Geobacteraceae suggests that these differences are due to
loss of ancestral genes. How the nitrate reductase of G.
metallireducens can function with the molybdopterin synthase complex being apparently incomplete is unknown.
In G. sulfurreducens, putative binding sites for the molybdate-sensing ModE protein (GSU2964) have been identified by the ScanACE software [41,42] in several locations,
and the existence of a ModE regulon has been predicted
[43]. The genes in the predicted ModE regulon (Additional file 3: Table S3) include one of the two succinyl:acetate CoA-transferases, a glycine-specific tRNA (anticodon
CCC, corresponding to 26% of glycine codons), several
transport systems, and some nucleases. In G. metallireducens, there is no full-length modE gene, but a gene encoding the C-terminal molybdopterin-binding (MopI)
domain of ModE (Gmet_0511) is present in the same
location (Figure 6). Phylogenetic analysis shows that the
Gmet_0511 gene product is the closest known relative of
G. sulfurreducens ModE, and that it has evolved out of the
Geobacteraceae/Chlorobiaceae cluster of full-length ModE
proteins by loss of the N-terminal ModE-specific domain
(data not shown). The ScanACE software detected only
one of the ModE-binding sites of G. sulfurreducens at the
corresponding location in the G. metallireducens genome,

but some vestigial sites were apparent when other syntenous locations were visually inspected (Additional file 3:
Table S3), indicating that the ModE regulon once existed
in G. metallireducens, but recent loss of the ModE N-terminal domain is allowing the regulatory sites to disappear
gradually over the course of genome sequence evolution
due to the absence of selective pressure for these sites to
remain conserved. Thus, genes that may be controlled globally by ModE in G. sulfurreducens and other Geobacteraceae to optimize molybdenum cofactor-dependent
processes have recently acquired independence in G. metallireducens.
Amino acid biosynthesis and its regulation
The two genomes differ in several aspects of amino acid
biosynthesis and its regulation. To make aspartate from
oxaloacetate, a homolog of Bacillus circulans aspartate
aminotransferase [44] is present in G. metallireducens
(Gmet_2078; 65% identical), whereas a homolog of the
Sinorhizobium meliloti enzyme [45] is found in G. sulfurreducens (GSU1242; 52% identical). Both species possess
asparagine synthetase (Gmet_2172 = GSU1953 and
Gmet_2024, 30% and 24% identical to asnB of B. subtilis
[46]) and glutamine synthetase (Gmet_1352 = GSU1835,
61% identical to glnA of Fremyella diplosiphon [47]), as well
as an aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase
operon (Gmet_0076, Gmet_0075, Gmet_0073 =
GSU3383, GSU3381, GSU3380, 36–53% identical to the
homologous subunits in B. subtilis [48]) that includes
glutamine
synthetase
adenylyltransferase
(glnE;
Gmet_0071 = GSU3378). The G. sulfurreducens glnE gene
may be inactive due to a deletion of ~ 45 codons in the Cterminal domain.

For biosynthesis of lysine, threonine and methionine, G.
metallireducens and other Geobacteraceae possess a linked

Page 8 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

(a)

http://www.biomedcentral.com/1471-2180/9/109

GSU2964

GSU2963

GSU2962

GSU2961

GSU2960

modE

modD

modA

modB

modC

GSU2699

GSU2700

GSU2701

GSU2702

GSU2703

moaE

tupB

tupA

tupC

moeA

GSU3147

GSU3146

moaA

moaC

moaB

GSU3145

mobA-mobB

GSU2704 GSU2705

mosC

(b)

Gmet_0511

moaD

Gmet_0513

Gmet_0514

mopI
Gmet_1044 Gmet_1043

Gmet_0512

modA

modB

modC

Gmet_1042

Gmet_1041

porin

tupB

moeB

Gmet_1040 Gmet_1039

tupA

tupC

Gmet_1038

moeA-1

Gmet_1037 Gmet_1036

moaC

moaB

Gmet_0300

Gmet_0301

Gmet_0302

Gmet_2095

Gmet_2094

mobA-mobB

moaA-1

mosC-1

moaA-3

mosC-2

Figure 6
G. sulfurreducens and G. metallireducens possess different genes for molybdenum cofactor biosynthesis
G. sulfurreducens and G. metallireducens possess different genes for molybdenum cofactor biosynthesis. (a) G. sulfurreducens has the global regulator modE. (b) G. metallireducens has multiple copies of moeA, moaA, and mosC, and putative integration host factor binding sites (black stripes). Both genomes have conserved genes (dark grey) for molybdate transport
(modABC) and molybdopterin biosynthesis (moeA, moaCB, mobA-mobB, mosC) alongside tup genes for tungstate transport
(white), but neither genome has all the genes thought to be essential for bis-(molybdopterin guanine dinucleotide)-molybdenum
biosynthesis (light grey). See also Table 1.

pair of aspartate-4-semialdehyde dehydrogenase genes:
Pseudomonas aeruginosa-type Gmet_0603 (69% identity)
[49] and Mycobacterium bovis-type Gmet_0604 (47% identity) [50], but G. sulfurreducens has only the former
(GSU2878). A haloacid dehalogenase family protein
(Gmet_1630 = GSU1694) encoded between two genes of
the threonine biosynthesis pathway could be the enzyme
required to complete the pathway, a phosphoserine:homoserine phosphotransferase analogous to that of
P. aeruginosa [51], and may overlap functionally with the
unidentified phosphoserine phosphatase required to
complete the biosynthetic pathway of serine.
Conserved nucleotide sequences (possible promoters and
riboswitches) were identified on the 5' sides of several

biosynthetic operons (Table 2). The lysine biosynthesis
operon in G. sulfurreducens and other Geobacteraceae
begins with a P. aeruginosa-type meso-diaminopimelate
decarboxylase (GSU0158; 51% identity) [52], whereas G.
metallireducens has two isoenzymes in other locations
(Gmet_0219, 30% identical to the E. coli enzyme [53],
with homologs in a few Geobacteraceae; Gmet_2019, 31%
identical to the P. aeruginosa enzyme [52], unique to G.
metallireducens). The recently identified L,L-diaminopimelate aminotransferase (dapL; Gmet_0213 =
GSU0162) [54] is co-transcribed with the dapAB genes
encoding the two preceding enzymes of lysine biosynthesis, but separated from them by a predicted short RNA element (Gmet_R1005 = GSU0160.1), also found in 23

Page 9 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

http://www.biomedcentral.com/1471-2180/9/109

Table 1: Genes of molybdenum cofactor biosynthesis in G. sulfurreducens and G. metallireducens.

Locus Gene in G. sulfurreducens

Gene in G. metallireducens

modE
modD

Gmet_05111
none

modA
modB
modC
moaD
moeB
moaE
moeA
moaC
moaB
mobA
mobB
moaA
mosC
pcmV
pcmW
pcmX

GSU2964
GSU2963

Function

regulation of molybdate-responsive genes
inner membrane protein, possible quinolinate
phosphoribosyltransferase
GSU2962
Gmet_0512
molybdate transport (periplasmic component)
GSU2961
Gmet_0513
molybdate transport (membrane component)
GSU2960
Gmet_0514
molybdate transport (ATP-binding component)
none
Gmet_1044
dithiolene addition to molybdopterin
(molybdopterin synthase small subunit)
none
Gmet_1043
molybdopterin synthase sulfurylase
GSU2699
none
dithiolene addition to molybdopterin
(molybdopterin synthase large subunit)
GSU2703
Gmet_1038; Gmet_0336; Gmet_1804 molybdenum-sulfur ligation?
GSU2704
Gmet_1037
molybdopterin precursor Z synthesis
GSU2705
Gmet_1036
molybdopterin precursor Z synthesis
GSU3147 N-terminal domain Gmet_0300 N-terminal domain
attachment of molybdopterin to guanosine
GSU3147 C-terminal domain Gmet_0300 C-terminal domain
attachment of molybdopterin to guanosine
GSU3146
Gmet_0301; Gmet_0337; Gmet_2095 molybdopterin precursor Z synthesis
GSU3145
Gmet_0302; Gmet_2094
molybdenum sulfurase
none
Gmet_2138
possible 4-hydroxybenzoyl-CoA reductase molybdenum cofactor
biosynthesis protein
none
Gmet_2139
possible 4-hydroxybenzoyl-CoA reductase molybdenum cofactor
biosynthesis protein
none
Gmet_2140
uncharacterized protein related to MobA

1Gmet_0511

is missing the N-terminal ModE domain but retains the C-terminal molybdopterin-binding MopI domains.

other locations on the G. metallireducens chromosome
(Additional file 4: Figure S1, Additional file 5: Table S4).
S-adenosylmethionine (SAM)-responsive riboswitches
(Table 2) may regulate homoserine O-acetyltransferase
(Gmet_2783 = GSU2462, 45% identical to the Leptospira
meyeri enzyme [55]), the first dedicated enzyme of
methionine biosynthesis, and also two linked cystathionine-γ-synthase/cystathionine-β-lyase genes (Gmet_0698
= GSU0944; Gmet_0699 = GSU0945, 49% and 51% identical to the Lactococcus lactis lyase [56,57]). Phylogenetic
analysis could not distinguish the synthase from the lyase
(data not shown), but their presence suggests that homocysteine can be made by transsulfuration of homoserine
with cysteine, and not only by the putative O-acetylhomoserine sulfhydrylases (Gmet_0819 = GSU2425,
Gmet_2390 = GSU1183 and Gmet_1566, 47%, 56% and
38% identical to the Emericella nidulans enzyme [58],
respectively). In G. metallireducens, transsulfuration may
also be controlled by a GC-rich element between
Gmet_0698 and Gmet_0699, which contains four tandem repeats of the heptanucleotide GGGACCG and is
found in 49 intergenic and intragenic locations in the
genome (Additional file 6: Figure S2, Additional file 5:
Table S4).
The leucine pathway-specific leuA gene (2-isopropylmalate synthase; Gmet_1265 = GSU1906, 49% identical
to the E. coli enzyme [59]) may be controlled by feedback

inhibition through a T-box [60] predicted to form an antiterminator structure in response to uncharged leucinespecific tRNA having the GAG anticodon (Gmet_R0037 =
GSUR030) (Table 2), putatively the only tRNA capable of
recognizing 55% of leucine codons in G. metallireducens
and 48% in G. sulfurreducens (CTC and CTT).
There are three 3-deoxy-D-arabino-heptulosonate-7phosphate (DAHP) synthase isoenzymes to catalyze the
first step of aromatic amino acid biosynthesis: one similar
to aroF of E. coli (Gmet_2375 = GSU2291, 55% identity
[61], but with a P148T substitution incompatible with
feedback inhibition by tyrosine [62]) and two Thermotoga
maritima-type enzymes (Gmet_0024 = GSU3333;
Gmet_0346 = GSU3142, 51% and 46% identity [63],
respectively). As one chorismate mutase is fused to prephenate dehydratase (pheA; Gmet_0862 = GSU2608, 41%
identical to the Pseudomonas stutzeri fusion protein [64]),
the other (Gmet_1955 = GSU1828, 30% identical to the
chorismate mutase domain of the P. stutzeri fusion protein) may function predominantly in tyrosine biosynthesis, possibly regulated by the adjacent gene product
(Gmet_1956 = GSU1829) that resembles the phenylalanine/tyrosine-responsive domain of T. maritima DAHP
synthase [65]. Gmet_1956 orthologs phylogenetically
cluster with the regulatory domains of Gmet_0024
orthologs (data not shown), suggesting that Gmet_0024
may be a tyrosine-inhibited DAHP synthase and
Gmet_0346 may be inhibited by another end product

Page 10 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

http://www.biomedcentral.com/1471-2180/9/109

Table 2: Conserved nucleotide sequences 5' of biosynthetic operons.

Operon

Locus tag and sequence coordinates
G. metallireducens

G. sulfurreducens

Gmet_P0076
93465..93502
Gmet_P0211
244588..244640
Gmet_R0069
384337..384528
Gmet_R0070
513498..513761
no match

GSU3383.1
3719308..3719345
GSU0157.1
176066..176117
GSUR082
3450692..3450963
GSU3011.1
3302884..3303201
GSU3004.1
3296929..3297108
GSUR063
1014004..1014271
GSU2461.2
2700118..2700220
GSU1906.1
2085440..2085740
GSU1903.1
2082057..2082203
GSU1704.1
1868745..1868863
GSU1269.1
1384886..1384920
GSU1739.1
1905464..1905561
GSU1757.1
1920275..1920400
GSU2195.1
2408782..2408854
GSU1197.1
1301091..1301163
GSUR060
640780..640988
GSU0589.1
622533..622801
GSU0149.1
167623..167663

aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase (gatCAB-mtnA-glnE-nth)
lysine (dapA)
aromatic amino acids (aroG-2)
cobalamin (cobUTSCB-thiC-2; cbiM-1-cbiQ-1-cbiO-1-cbiX-cobH-cbiD-cobLIM-cbiG-cobQ-cbiB-cobD)

methionine (metC-1-metC-2; metX)1

leucine (leuA)2
leucine/isoleucine (leuCD)
coenzyme A (panBC)
pyrimidines (pyrRBC-carAB)
tryptophan (iorAB-paaK)
purines, pyrimidines (purMN, rimI-pyrKD)
guanine (guaBA)
serine (serA)
thiamin (thiE/D-thiC-1; thiS-1-thiG-tenI)3

arginine (argBDFG)

Gmet_R0073
765279..765444
Gmet_R0129
3145553..3145656
Gmet_P1265
1425160..1425452
Gmet_P1268
1428650..1428793
Gmet_P1642
1843163..1843275
Gmet_P1768
1983157..1983191
Gmet_P1827
2042198..2042288
Gmet_P1844
2056600..2056732
Gmet_P2293
2600787..2600857
Gmet_P2378
2689446..2689518
Gmet_R0131
3292750...3292897
Gmet_R0134
3319520..3319741
Gmet_P0203
3719308..3719345

1The

sequence 5' of metC-1, metC-2, and metX is a SAM-responsive riboswitch.
sequence 5' of leuA is a T-box, an RNA structure that recognizes the aminoacylation state of tRNA.
3The sequence 5' of thiamin biosynthesis operons is a thiamin diphosphate-responsive riboswitch.
2The

such as phenylalanine. A predicted short RNA element
(Gmet_R0069 = GSUR082, Table 2), found 5' of
Gmet_0346 and its orthologs in several Geobacteraceae,
may participate in regulation of this isoenzyme's expression.
In all non-Geobacteraceae that possess an indole-scavenging tryptophan synthase β2 protein, it is encoded apart
from the trp operon containing the trpAB1 genes for the α
(indole-producing) and β1 (indole-consuming) subunits
of tryptophan synthase [66]. In G. metallireducens and G.
sulfurreducens, however, the β2 gene trpB2 (Gmet_2493 =
GSU2379, 60% identical to the T. maritima protein [67])
is the penultimate gene of the predicted trp operon and
the trpB1 (Gmet_2482 = GSU2375, 66% identical to the
Acinetobacter calcoaceticus protein [68]) and trpA

(Gmet_2477 = GSU2371, 47% identical to the Azospirillum brasilense protein [69]) genes are separated from the 3'
end of the operon and from each other by three or more
intervening genes, most of which are not conserved
between the two genomes (not shown). Next to the trpB2
gene of G. metallireducens is one of 24 pairs of a conserved
nucleotide motif (Additional file 7: Figure S3, Additional
file 5: Table S4) hypothesized to bind an unidentified global regulator protein. Other, evolutionarily related paired
sites where another unidentified global regulator may
bind (Additional file 8: Figure S4, Additional file 5: Table
S4) are found in 21 locations. Between the proBA genes of
G. metallireducens, encoding the first two enzymes of proline biosynthesis (Gmet_3198-Gmet_3199 = GSU3212GSU3211, 41% and 45% identical to the E. coli enzymes
[70]), is one of eight pairs of predicted binding sites for yet

Page 11 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

another unidentified global regulator (Additional file 9:
Figure S5, Additional file 5: Table S4). In G. sulfurreducens,
the space between proBA is occupied by a different conserved nucleotide sequence (not shown), found only in
four other places in the same genome. Overall, a comparison of the two genomes offers insight into unique features of amino acid biosynthesis and its regulation that
deserve further study.
Nucleotide metabolism
Differences in nucleotide metabolism were identified in
the two genomes. G. metallireducens has acquired a possibly redundant large subunit of carbamoyl-phosphate synthetase (Gmet_0661, 50% identical to the P. aeruginosa
protein [71]) in addition to the ancestral gene
(Gmet_1774 = GSU1276, 65% identity to P. aeruginosa),
Both genomes encode a second putative thymidylate
kinase (Gmet_3250 = GSU3301) distantly related to all
others, in addition to the one found in other Geobacteraceae (Gmet_2318 = GSU2229, 41% identical to the E. coli
enzyme [72]). G. sulfurreducens has evidently lost the purT
gene product of G. metallireducens and several other Geobacteraceae (Gmet_3193, 58% identical to the E. coli
enzyme [73]), which incorporates formate directly into
purine nucleotides instead of using the folate-dependent
purN gene product (Gmet_1845 = GSU1759, 46% identical to the E. coli enzyme [74]).
Carbohydrate metabolism
Comparative genomics indicates that, similar to most
Geobacter species, G. metallireducens possesses two glyceraldehyde-3-phosphate
dehydrogenase
isoenzymes:
Gmet_1211 and Gmet_1946 (59% and 56% identical to
gluconeogenic GapB and glycolytic GapA of Corynebacterium glutamicum [75], respectively), but G. sulfurreducens
has an ortholog of only the latter (GSU1629). G. metallireducens also has a putative fructose 6-kinase (Gmet_2805,
39% identical to the E. coli enzyme [76]) that is not
present in G. sulfurreducens. Remarkably, G. metallireducens possesses two isoenzymes each of UDP-glucose 4-epimerase (Gmet_1486; Gmet_2329 = GSU2240, 50% and
54% identical to the A. brasilense enzyme [77]),
glutamine:fructose-6-phosphate
aminotransferase
(Gmet_1487; Gmet_0104 = GSU0270, 55% and 53%
identical to the Thermus thermophilus enzyme [78]), GDPmannose 4,6-dehydratase (Gmet_1488 = GSU0626;
Gmet_1311, 61% and 72% identical to the E. coli enzyme
[79]) and UDP-N-acetylglucosamine 2-epimerase
(Gmet_1489 = GSU2243, 61% identical to the E. coli
enzyme [80]; Gmet_1504, 39% identical to the Methanococcus maripaludis enzyme [81]). G. metallireducens has
evolved a gene cluster of the four enzyme activities
(Gmet_1486-Gmet_1489) from both ancestral gene
duplication and lateral gene transfer (data not shown).
The reason for this emphasis on interconversion of hex-

http://www.biomedcentral.com/1471-2180/9/109

oses in G. metallireducens versus G. sulfurreducens is
unknown.
Unlike the genomes of G. sulfurreducens and most other
Geobacteraceae, which encode the enzymes of only the
non-oxidative branch of the pentose phosphate pathway,
the G. metallireducens genome includes a cluster of oxidative pentose phosphate pathway enzyme genes: 6-phosphogluconolactonase (Gmet_2618, 30% identical to the
Pseudomonas putida enzyme [82]), glucose-6-phosphate
dehydrogenase (Gmet_2619, 50% identical to the Nostoc
punctiforme enzyme [83]), and 6-phosphogluconate dehydrogenase (Gmet_2620, 36% identical to YqeC of B. subtilis [84]), along with two ribose-5-phosphate isomerase
isoenzymes (Gmet_2621 and Gmet_1604 = GSU1606,
39% and 44% identical to RpiB of E. coli [85]). Thus, G.
metallireducens apparently generates biosynthetic reducing
equivalents in the form of NADPH from carbohydrates.
The NADPH supply of G. sulfurreducens, in contrast, may
derive from the electron transfer chain via a ferredoxin:NADP+ reductase (GSU3058-GSU3057, each 52%
identical to its Pyrococcus furiosus homolog [86]) that is
found in other Geobacteraceae, but not in G. metallireducens.
Both G. sulfurreducens and G. metallireducens may protect
themselves from desiccation by making trehalose from
glucose storage polymers via maltooligose in three steps
catalyzed by an alpha-amylase domain protein
(Gmet_3469 = GSU2361), maltooligosyltrehalose synthase (Gmet_3468 = GSU2360, 35% identical to the
Rhizobium leguminosarum enzyme [87]), and maltooligosyltrehalose trehalohydrolase (Gmet_3467 = GSU2358,
44% identical to the Arthrobacter strain Q36 enzyme [88]).
G. sulfurreducens, P. propionicus and G. lovleyi may also
make trehalose from glucose-6-phosphate by the sequential action of trehalose-6-phosphate synthase (GSU2337,
containing a domain 37% identical to the Mycobacterium
tuberculosis enzyme [89]) and trehalose-6-phosphatase
(GSU2336, 29% identical to the E. coli enzyme [90]),
which are missing in G. metallireducens. Thus, G. sulfurreducens is capable of achieving osmotolerance without consuming carbohydrate storage polymers, but G.
metallireducens is not.
Biogenesis of c-type cytochromes and pili
The genome of G. metallireducens encodes 91 putative ctype cytochromes, of which 65 have homologs among the
103 c-type cytochromes of G. sulfurreducens. Of the c-type
cytochrome genes implicated in Fe(III) and U(VI) reduction in G. sulfurreducens, those conserved in G. metallireducens are macA (Gmet_3091 = GSU0466) [91-93] and ppcA
(Gmet_2902 = GSU0612) [37], whereas different c-type
cytochrome sequences are found in syntenous locations
where one would expect omcB and omcC (Gmet_0910 ≠

Page 12 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

GSU2737; Gmet_0913 ≠ GSU2731) [94], and omcE
(Gmet_2896 ≠ GSU0618) [95]. The G. metallireducens
genome contains no genes homologous to omcS
(GSU2504) and omcT (GSU2503) [95], and only a paralog (Gmet_0155 = GSU2743) of omcF (GSU2432) [96].
This lack of conservation is being investigated further (J.
Butler, personal communication).
Notable differences between G. metallireducens and G. sulfurreducens are apparent in the biogenesis of c-type cytochromes, in biosynthesis of the heme group, and in
reduction of disulfide bonds to allow covalent linkage to
heme. In addition to the membrane-peripheral protoporphyrinogen IX oxidase of G. sulfurreducens and other Geobacteraceae, encoded by the hemY gene (Gmet_3551 =
GSU0012, 38% identical to the Myxococcus xanthus
enzyme [97]), G. metallireducens has a membrane-integral
isoenzyme encoded by hemG (Gmet_2953, 43% identical
to the E. coli enzyme [98]), with a homolog in Geobacter
FRC-32. These two species also possess a putative
disulfide bond reduction system not found in G. sulfurreducens and other Geobacteraceae, comprised of DsbA,
DsbB, DsbE and DsbD homologs (Gmet_1380,
Gmet_1381, Gmet_1383, Gmet_1384), encoded in a
cluster alongside a two-component signalling system
(Gmet_1378-Gmet_1379),
an
arylsulfotransferase
(Gmet_1382), and a conserved protein of unknown function (Gmet_1385). Transcription of dsbA and dsbB is
diminished during growth on benzoate [21], and phylogenetic analysis indicates that these DsbA and DsbB proteins belong to subfamilies distinct from those that have
been characterized (R. Dutton, personal communication).
Located apart from this cluster, DsbC/DsbG (Gmet_2250)
of G. metallireducens has homologs in several Geobacteraceae, but not in G. sulfurreducens. However, CcdA/DsbD
(Gmet_2451 = GSU1322) is present in both. Thus, the
pathways of c-type cytochrome biogenesis may be significantly different in the two species and somehow linked to
the degradation of aromatic compounds by G. metallireducens.
In both G. sulfurreducens and G. metallireducens, there are
four c-type cytochrome biogenesis genes related to ResB of
B. subtilis [99], each predicted to be co-transcribed with a
gene encoding a ResC/HemX-like protein (hypothesized
to be a heme transporter with eight predicted transmembrane segments) [100] and several multiheme c-type cytochrome genes (Additional file 10: Table S5). One more
protein of the ResC/HemX-like family (Gmet_3232 =
GSU3283) is encoded among enzymes of heme biosynthesis in both genomes. These gene arrangements suggest
that each pair of c-type cytochrome biogenesis proteins
may be dedicated to the efficient expression of the cytochromes encoded nearby. Two of the pairs are orthologously conserved (Gmet_2901-Gmet_2900 = GSU0613-

http://www.biomedcentral.com/1471-2180/9/109

GSU0614; Gmet_0592..Gmet_0594 = GSU2891GSU2890); the other two pairs (Gmet_0572-Gmet_0573;
Gmet_0578-Gmet_0579;
GSU0704-GSU0705;
GSU2881.1-GSU2880), which appear to derive from
expansion of ancestral genes, may be relevant to the diversified c-type cytochrome repertoire of the two species.
Interestingly, three of these gene pairs in G. metallireducens
are arranged in proximity to each other in a cluster of ten
operons with the same coding DNA strand (Gmet_0571
to Gmet_0601), suggesting that their expression may be
co-ordinated by transcriptional readthrough (Additional
file 10: Table S5). The purposes of various pairs of c-type
cytochrome biogenesis proteins in Geobacteraceae remain
to be determined.
The pili of G. sulfurreducens have been implicated in electron transfer [101,102] and biofilm formation [103].
Most genes attributed to pilus biogenesis in G. sulfurreducens have orthologs in G. metallireducens, suggesting that
these roles of pili may be conserved. However, instead of
the ancestral pilY1 gene found in G. sulfurreducens
(GSU2038) and other Geobacteraceae, which may encode
a pilus tip-associated adhesive protein [104], G. metallireducens possesses a phylogenetically distinct pilY1 gene in
the same location (Gmet_0967; data not shown), surrounded by different genes of unknown function within a
cluster of pilus biogenesis genes. Therefore, it remains
possible that structural and functional differences
between the pili of the two species will be identified in
future.
Solute transport systems
Although the substrates of most solute transport systems
of G. metallireducens and G. sulfurreducens are unknown,
several features distinguish the two species (Additional
file 11: Table S6). One of two predicted GTP-dependent
Fe(II) transporters of the Geobacteraceae (feoB-1
Gmet_2444 = GSU1380), located next to the ferric uptake
regulator gene (fur Gmet_2445 = GSU1379), is present in
G. metallireducens; the other (feoB-2 GSU3268), with two
feoA genes on its 5' side (GSU3268.1, GSU3270) potentially encoding an essential cytosolic component of the
transport system [105], is not. Phylogenetic analysis
showed that the FeoB-2 proteins of Geobacteraceae are
closely related to the characterized Fe(II)-specific FeoB
proteins of Porphyromonas gingivalis [106] and Campylobacter jejuni [107], whereas the FeoB-1 proteins of Geobacteraceae cluster apart from them (data not shown).
FeoB-1 proteins are not closely related to the manganesespecific FeoB of P. gingivalis [106] either, and so their substrate specificity cannot be assigned at present.

In G. metallireducens, duplicate kup genes, predicted to
encode low-affinity potassium/proton symporters, are
found in one place (Gmet_0038 = GSU3342; Gmet_0039

Page 13 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

= GSU2485, 29% and 31% identical to the E. coli protein
[108]), apart from the kdpABCDE genes (Gmet_2433Gmet_2437 = GSU2480-GSU2484, 38–49% identical to
the homologs in E. coli [109,110]) encoding an osmosensitive potassium-translocating ATPase complex. In G. sulfurreducens, one of these kup genes (GSU2485) is located
3' of the kdp gene cluster, apparently under control of an
osmosensitive riboswitch (GSU2484.1, sequence coordinates 2728254 to 2728393), and there is a third kup gene
(GSU2350, 49% identity to E. coli) not found in other
Geobacteraceae. G. sulfurreducens also has at least two
potassium/proton antiporters (GSU1203, 34% identical
to CvrA of Vibrio parahaemolyticus [111]; GSU2759, 31%
identical to KefB of E. coli [112]) and a sodium/proton
antiporter complex (mrpABCDEFG GSU2344-GSU2338,
29–48% identical to the homologs in B. subtilis [113])
that are not found in G. metallireducens. Three mechanosensitive ion channels are common to the two species
(Gmet_1942 = GSU1633; Gmet_2581 = GSU2316; and
Gmet_2522 = GSU2794); two more are unique to G. sulfurreducens (GSU1557; GSU1723). Thus, control of
monovalent cation homeostasis appears to be more complex in G. sulfurreducens.
Several heavy metal efflux pumps are conserved between
the two species, but their substrate specificity is uncertain.
Transporters present in G. sulfurreducens but not G. metallireducens include that for uracil (GSU0932, 48% identical
to the Bacillus caldolyticus protein [114]). Transporters
present in G. metallireducens but not G. sulfurreducens
include
those
for
nitrate/nitrite
(Gmet_0333Gmet_0334) and chromate (Gmet_2732-Gmet_2731),
which are each present as two paralogous genes rather
than gene fusions such as their homologs that have been
characterized in other bacteria [36,115].
Signalling, chemotaxis and global regulation
G. metallireducens possesses orthologs of the six sigma factors of RNA polymerase identified in G. sulfurreducens
(Table 3), as well as a seventh factor (Gmet_2792) not
found in other Geobacteraceae, related to the extracytoplasmic sigma-Z factor of B. subtilis [116]. Intriguingly, a particular anti-anti-sigma factor gene is frameshifted in both

http://www.biomedcentral.com/1471-2180/9/109

genomes: GSU1427 has frameshifts in the phosphatase
domain, resulting in an in-frame protein, whereas the
homologous Gmet_1229 is shifted out of frame in the
kinase domain. These differences imply that global regulatory networks may be different in the two species.
The G. metallireducens genome encodes 83 putative sensor
histidine kinases containing HATPase_c domains (Additional file 12: Table S7), of which 45 (54%) have
orthologs among the 95 such proteins of G. sulfurreducens.
There are 94 proteins with response receiver (REC)
domains in G. metallireducens (Additional file 12: Table
S7), out of which 66 (70%) have orthologs among the
110 such proteins of G. sulfurreducens. Twenty-seven of the
REC domain-containing proteins and another 101 genes
and four pseudogenes (Additional file 12: Table S7) were
predicted to be transcriptional regulators in G. metallireducens. There are 20 putative diguanylate cyclases containing
GGDEF domains, of which 16 (80%) have orthologs
among the 29 putative diguanylate cyclases of G. sulfurreducens (Additional file 13: Table S8). Overall, the portion
of the genome dedicated to signalling and transcriptional
regulation in G. metallireducens is slightly less than in G.
sulfurreducens, but still considerable and significantly different in content.
Several protein factors involved in chemotaxis-type signalling pathways are conserved between the two
genomes: G. sulfurreducens and G. metallireducens each
possess four or five CheA sensor kinases and ten CheY
response receivers, almost all of which are orthologous
pairs (Additional file 14: Table S9). In contrast, 17 of the
34 methyl-accepting chemotaxis proteins (MCPs) of G.
sulfurreducens have no full-length matches in G. metallireducens (Additional file 14: Table S9). Due to apparent
gene family expansion in G. sulfurreducens, its remaining
17 MCPs correspond to only 13 MCPs of G. metallireducens (Additional file 14: Table S9). The other five MCPs of
G. metallireducens lack full-length matches in other Geobacteraceae (Additional file 14: Table S9). Whereas G. sulfurreducens may use its closely related MCPs to fine-tune
its chemotactic responses, G. metallireducens may accomplish response modulation by having twice as many MCP

Table 3: Sigma factors of G. metallireducens and G. sulfurreducens.

Locus Tag

Annotation

G. metallireducens gene

G. sulfurreducens gene

rpoH
rpoE
rpoN
rpoD
rpoS
fliA
none

RNA polymerase sigma-32 factor
RNA polymerase sigma-24 factor, putative
RNA polymerase sigma-54 factor
RNA polymerase sigma-70 factor RpoD
RNA polymerase sigma-38 factor, stationary phase
RNA polymerase sigma-28 factor for flagellar operon
RNA polymerase sigma-Z factor

Gmet_2854
Gmet_2612
Gmet_1283
Gmet_0395
Gmet_1421
Gmet_0429
Gmet_2792

GSU0655
GSU0721
GSU1887
GSU3089
GSU1525
GSU3053
none

Page 14 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

methyltransferases (CheR) and methylesterases (CheB) as
G. sulfurreducens (Additional file 14: Table S9).
Integration host factors (IHF) and histone-like (HU)
DNA-binding proteins are global regulators of gene
expression composed of two homologous proteins that
bend DNA in specific locations [117]. IHF/HU binding
sites are favoured by some mobile genetic elements for
insertion. The genome of G. metallireducens encodes
orthologs of the single HU protein, both IHF beta proteins, and one of two IHF alpha proteins of G. sulfurreducens (Table 4). Another HU gene and two additional IHF
alpha genes are present in G. metallireducens but not G. sulfurreducens (Table 4). Three sets of putative global regulatory elements unique to the G. metallireducens genome
(Additional files 7,8,9: Figures S3, S4 and S5, Additional
file 5: Table S4) may be recognized by different combinations of IHF/HU proteins. A fourth set found in G. metallireducens (Additional file 15: Figure S6, Additional file 5:
Table S4) is similar to multicopy sequences in many other
genomes. Two transposons (ISGme8 and ISGme9) were
found inserted near putative IHF/HU-binding sites of
Class 1 (Additional file 5: Table S4). No such putative global regulatory sequence elements were identified in G. sulfurreducens. However, pirin, a Fe(II)-binding protein that
associates with DNA in eukaryotic nuclei [118,119], is
present in G. sulfurreducens as GSU0825, but in G. metallireducens only as a frameshifted fragment, Gmet_3471.
These genetic differences indicate that the proteins that
decorate and bend the chromosome are very different in
the two species.
Although no quorum sensing through N-acylhomoserine
lactones (autoinducers) has ever been demonstrated for
any Geobacteraceae, this kind of signalling may be possible
for G. metallireducens because it possesses a LuxR family
transcriptional regulator with an autoinducer-binding
domain (Gmet_1513), and two divergently transcribed
genes with weak sequence similarity to autoinducer synthetases (Gmet_2037 and Gmet_2038). Both Gmet_2037
and Gmet_2038 have atypically low G+C content (Additional file 1: Table S1) and may have been recently
acquired by G. metallireducens. The presence of a conserved nucleotide sequence on the 5' side of Gmet_2037
and in 15 other locations on the chromosome (Additional
file 16: Figure S7, Additional file 5: Table S4) suggests that
Gmet_2037 may be an unusual autoinducer synthetase
that is regulated by a riboswitch rather than an autoinducer-binding protein. This conserved sequence is also
found on the 5' side of many genes (frequently c-type
cytochromes) in the genomes of G. sulfurreducens, G. uraniireducens, and P. propionicus, and overlaps with predicted
cyclic diguanylate-responsive riboswitches [120].
The genomes of G. metallireducens and G. sulfurreducens
differ in several other aspects of regulation. Nine pairs of

http://www.biomedcentral.com/1471-2180/9/109

Table 4: Integration host factor (IHF) and histone-like (HU)
genes of G. metallireducens and G. sulfurreducens.

Locus Tag

G. metallireducens gene

G. sulfurreducens gene

ihfA-1
ihfA-2
ihfA-3
ihfA-4
ihfB-1
ihfB-2
hup-1
hup-2

Gmet_1417
none
Gmet_3057
Gmet_3056*
Gmet_1833
Gmet_0868
Gmet_0355
Gmet_1608

GSU1521
GSU2120
none
none
GSU1746
GSU2602
GSU3132
none

*Gmet_3056 is frameshifted near the N-terminus, but may be
expressed from an internal start codon.
The functions and associations of the various IHF alpha (ihfA), IHF
beta (ihfB), and HU (hup) genes are yet unknown, as is their
correspondence to any of the predicted regulatory sites illustrated in
Figures S3, S4, S5, and S6.

potential toxins and antitoxins were identified in the G.
metallireducens genome (Additional file 17: Table S10),
which may poison vital cellular processes in response to
stimuli that interfere with their autoregulation. Only one
of these was similar to one of the five potential toxin/antitoxin pairs of G. sulfurreducens. Both the CRISPR1 and
CRISPR2 (clustered regularly interspaced short palindromic repeat) loci of G. sulfurreducens, thought to encode
181 short RNAs that may provide immunity against infection by unidentified phage and plasmids [121,122], have
no parallel in G. metallireducens, which has CRISPR3 (also
found in G. uraniireducens) instead, encoding only twelve
putative short RNAs of more variable length and
unknown target specificity (Additional file 18: Table S11).
Another difference in RNA-level regulation is that a singlestranded RNA-specific nuclease of the barnase family
(Gmet_2616) and its putative cognate inhibitor of the
barstar family (Gmet_2617) are present in G. metallireducens but not G. sulfurreducens.
Several conserved nucleotide sequences were identified by
comparison of intergenic regions between the G. sulfurreducens and G. metallireducens genomes, and those that are
found in multiple copies (Additional file 19: Figure S8,
Additional file 5: Table S4) may give rise to short RNAs
with various regulatory or catalytic activities.

Conclusion
Inspection of the G. metallireducens genome indicates that
this species has many metabolic capabilities not present
in G. sulfurreducens, particularly with respect to the metabolism of organic acids. Many biosynthetic pathways and
regulatory features are conserved, but several putative global regulator-binding sites are unique to G. metallireducens. The complement of signalling proteins is
significantly different between the two genomes. Thus,
the genome of G. metallireducens provides valuable infor-

Page 15 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

mation about conserved and variable aspects of metabolism, physiology and genetics of the Geobacteraceae.

Methods
Sequence analysis and annotation
The genome of G. metallireducens GS-15 [31] was
sequenced by the Joint Genome Institute from cosmid
and fosmid libraries. Two gene modeling programs – Critica (v1.05), and Glimmer (v2.13) – were run on both replicons [GenBank:NC007517, GenBank:NC007515],
using default settings that permit overlapping genes and
using ATG, GTG, and TTG as potential starts. The results
were combined, and a BLASTP search of the translations
vs. Genbank's non-redundant database (NR) was conducted. The alignment of the N-terminus of each gene
model vs. the best NR match was used to pick a preferred
gene model. If no BLAST match was returned, the longest
model was retained. Gene models that overlapped by
greater than 10% of their length were flagged for revision
or deletion, giving preference to genes with a BLAST
match. The revised gene/protein set was searched against
the Swiss-Prot/TrEMBL, PRIAM, Pfam, TIGRFam, Interpro, KEGG, and COGs databases, in addition to BLASTP
vs. NR. From these results, product assignments were
made. Initial criteria for automated functional assignment
set priority based on PRIAM, TIGRFam, Pfam, Interpro
profiles, pairwise BLAST vs. Swiss-Prot/TrEMBL, KEGG,
and COG groups. tRNAs were annotated using tRNAscanSE (v1.23). rRNAs were annotated using a combination of
BLASTN and an rRNA-specific database. The srpRNA was
located using the SRPscan website. The rnpB and tmRNA
were located using the Rfam database and Infernal. Riboswitches and other noncoding RNAs predicted in the G. sulfurreducens genome [GenBank:NC00293] were retrieved
from the Rfam database [123] and used to annotate the
corresponding sequences in G. metallireducens.

Operon organization was predicted using the commercial
version of the FGENESB software (V. Solovyev and A.
Salamov, unpublished; Softberry, Inc; 2003–2007), with
sequence parameters estimated separately from the G. sulfurreducens and G. metallireducens genomes. Default
parameters were used in operon prediction, including
minimum ORF length of 100 bp.
Binding sites of the global regulator ModE (consensus
were predicted
using ScanACE software [41,42] using the algorithm of
Berg and von Hippel [124] and the footprinted matrix of
E. coli ModE-regulated sites from the Regulon DB database v 4.0 [125]. Functional annotations of transport proteins were evaluated by referring to TCDB http://
www.tcdb.org, and PORES http://garlic.mefos.hr/pores
was used to annotate porins. Transposase families were
assigned ISGme numbers for inclusion in the ISFinder
database http://www-is.biotoul.fr.

http://www.biomedcentral.com/1471-2180/9/109

Manual curation
The automated genome annotation of G. metallireducens
was queried with the protein BLAST algorithm [126] using
all predicted proteins in the automated annotation of the
G. sulfurreducens genome [12] to identify conserved genes
that aligned over their full lengths. The coordinates of
numerous genes in both genomes were adjusted according to the criteria of full-length alignment, plausible ribosome-binding sites, and minimal overlap between genes
on opposite DNA strands. The annotations of all other
genes in G. metallireducens were checked by BLAST
searches of NR. Discrepancies in functional annotation of
conserved genes between the two genomes were also
resolved by BLAST of NR and of the Swiss-Prot database.
All hypothetical proteins were checked for similarity to
previously identified domains, conservation among other
Geobacteraceae, and absence from species other than Geobacteraceae. Genes that had no protein-level homologs in
NR were checked (together with flanking intergenic
sequences) by translated nucleotide BLAST in all six reading frames, and by nucleotide BLAST to ensure that conserved protein-coding or nucleotide features had not been
missed. All intergenic regions of 120 bp or larger were also
checked, which led to the annotation of numerous conserved nucleotide sequences numbered as follows:
Gmet_R#### (for predicted RNAs and miscellaneous conserved sequences, a nonzero first digit indicating membership in a group of four or more sequences); Gmet_P####
(for conserved, putative regulatory sequences 5' of predicted operons, numbers corresponding to the first gene
of the operon); Gmet_I[1-4]## [A, B] (for the four classes
of putative global regulator binding sites, mostly found in
pairs); Gmet_H4## (for putative global regulatory elements consisting of four tandem heptanucleotide
repeats); and Gmet_C### (for the spacers of clustered regularly interspaced short palindromic repeats – CRISPR).
Newly added features in the G. sulfurreducens genome
were assigned unique numbers with decimal points
(GSU####.#) in accordance with earlier corrections.
Phylogenetic analysis
Phylogenetic analysis of selected proteins was performed
on alignments generated using T-COFFEE [127], manually corrected in Mesquite [128]. Phylogenetic trees were
constructed by the neighbour-joining method using
Phylip software [129], with 500 bootstrap replications.

ATCGCTATATANNNNNNTATATAACGAT)

Abbreviations
ATP: adenosine triphosphate; CoA: coenzyme A; CRISPR:
clustered regularly interspaced short palindromic repeats;
DAHP: 3-deoxy-D-arabino-heptulosonate-7-phosphate;
DNA: deoxyribonucleic acid; GDP: guanosine diphosphate; GTP: guanosine triphosphate; HAD: haloacid
dehalogenase; HU: histone-like DNA-binding proteins;
IHF: integration host factors; MCP: methyl-accepting
chemotaxis protein; NAD(H): nicotinamide adenine
Page 16 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

dinucleotide (reduced); NADP(H): nicotinamide adenine
dinucleotide phosphate (reduced); RNA: ribonucleic acid;
SAM: S-adenosylmethionine; TCA: tricarboxylic acid;
tRNA: transfer RNA; UDP: uridine diphosphate

Authors' contributions
AL supervised the genome sequencing, GD performed
genome sequence finishing, and ML supervised the automated annotation process. JK predicted ModE binding
sites. MA performed manual curation of the genome
annotations, sequence alignments and phylogenetic analyses, and wrote the manuscript. DL conceived of the study
and offered guidance with the writing. All authors read,
assisted with editing, and approved the final manuscript.

Additional material

http://www.biomedcentral.com/1471-2180/9/109

Additional File 5
Table S4. Genes found next to multicopy nucleotide sequences of
unknown function in G. metallireducens. This table lists the genes
adjacent to all of the multicopy nucleotide sequences identified in the G.
metallireducens genome.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S5.pdf]

Additional File 6
Figure S2. A family of 49 predicted regulatory RNA elements in G.
metallireducens, containing four heptanucleotide repeats (consensus
GGACCGG). This is an alignment of 49 DNA sequences that were
matched by nucleotide-level BLAST. These elements are found within
genes, sometimes more than once per gene, as well as between genes. The
sequence strand and start and stop nucleotide positions are indicated.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S6.pdf]

Additional File 1
Table S1. Genes of G. metallireducens with atypical G+C content
(more than two standard deviations from the mean). This table lists
genes of G. metallireducens that have G+C content more than two
standard deviations from the mean, and indicates by shading (alternated
for contrast) those gene clusters that may be recent acquisitions.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S1.pdf]

Additional File 7

Table S2. Enzymes of acyl-CoA metabolism in G. sulfurreducens and
G. metallireducens. This table compares the genes predicted to function
in acyl-CoA metabolism in G. sulfurreducens and G. metallireducens.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S2.pdf]

Figure S3. Predicted global regulator binding sites (class 1). This is an
alignment of 48 DNA sequences that were matched by nucleotide-level
BLAST. Each site contains four tandem octanucleotide repeats (consensus
GTTGCTYN), the outer two being poorly conserved. The distance between
each pair of sites (on opposite strands) is variable. Each sequence begins
at the right extremity of the top line (the 3' side of the "-" strand of the
chromosome), loops on the left side (switching strands), and continues to
the right extremity of the bottom line (the 3' side of the "+" strand of the
chromosome); start and stop nucleotide positions are indicated. Insertion
sequences of the ISGme8 or ISGme9 families may be found at a fixed distance from either or both sites of a pair; these occurrences are indicated on
the appropriate lines.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S7.pdf]

Additional File 3

Additional File 8

Table S3. Predicted binding sites of the global regulator ModE in the
genome of G. sulfurreducens, which are mostly absent from the G.
metallireducens genome. This table lists the predicted ModE-binding
sites of G. sulfurreducens and compares them to the corresponding
sequences in G. metallireducens.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S3.pdf]

Figure S4. Predicted global regulator binding sites (class 2). This is an
alignment of 47 DNA sequences that were matched by nucleotide-level
BLAST. Each of 21 paired sites, four sites that also belong to class 1, and
one possibly vestigial unpaired site contains three tandem repeats (consensus TCTCCGTS[Y]). The distance between each pair of sites (on opposite
strands) is variable. Each sequence begins at the right extremity of the top
line (the 3' side of the "-" strand of the chromosome), loops on the left side
(switching strands), and continues to the right extremity of the bottom
line (the 3' side of the "+" strand of the chromosome); start and stop
nucleotide positions are indicated.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S8.pdf]

Additional File 2

Additional File 4
Figure S1. A family of 24 predicted short RNA elements in the G. metallireducens genome. This is an alignment of 24 DNA sequences that
were matched by nucleotide-level BLAST. Each RNA is found in an intergenic region, e.g. the 5' regions of genes affecting lysine/arginine metabolism, and contains a central palindromic structure
GRCGTAGCGCTGCTACGCC. Similar sequences were found in the
genomes of G. sulfurreducens, G. uraniireducens, and Desulfotalea
psychrophila. The sequence strand and start and stop nucleotide positions are indicated.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S4.pdf]

Additional File 9
Figure S5. Predicted global regulator binding sites (class 3). This is an
alignment of 16 DNA sequences that were matched by nucleotide-level
BLAST. Fifteen of the sites consist of five tandem heptanucleotide repeats
(consensus MTYCTGA). Each sequence begins at the right extremity of
the top line (the 3' side of the "-" strand of the chromosome), loops on the
left side (switching strands), and continues to the right extremity of the
bottom line (the 3' side of the "+" strand of the chromosome); start and
stop nucleotide positions are indicated.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S9.pdf]

Page 17 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

http://www.biomedcentral.com/1471-2180/9/109

Additional File 10

Additional File 16

Table S5. Cytochrome c biogenesis gene clusters of G. sulfurreducens
and G. metallireducens, and associated c-type cytochromes. This
table compares the clusters of genes predicted to be involved in biogenesis
of c-type cytochromes in G. sulfurreducens and G. metallireducens.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S10.pdf]

Figure S7. A predicted regulatory short RNA found in the 5' regions
of c-type cytochromes and other proteins. This is an alignment of 16
DNA sequences that were matched by nucleotide-level BLAST. The location of Gmet_R3013 suggests that N-acylhomoserine lactone signalling
may be under control of this RNA element. Similar sequences were found
in the genomes of G. sulfurreducens, G. uraniireducens, and P. propionicus. The sequence strand and start and stop nucleotide positions are
indicated.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S16.pdf]

Additional File 11
Table S6. Transport systems of G. sulfurreducens and G. metallireducens. This table compares the genes predicted to be involved in transport of solutes across the cell membrane and cell wall of G.
sulfurreducens and G. metallireducens.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S11.pdf]

Additional File 12
Table S7. Sensor histidine kinases (HATPase_c domain proteins),
REC domain-containing proteins, and transcriptional regulators of G.
metallireducens. This table compares the genes predicted to be involved
in two-component signalling and transcriptional regulation in G. sulfurreducens and G. metallireducens.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S12.pdf]

Additional File 13
Table S8. Diguanylate cyclases (GGDEF domain proteins) of G. sulfurreducens and G. metallireducens. This table compares the genes
predicted to produce the intracellular messenger cyclic diguanylate in G.
sulfurreducens and G. metallireducens.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S13.pdf]

Additional File 14
Table S9. Chemotaxis-type signalling proteins of G. sulfurreducens
and G. metallireducens. This table compares the genes predicted to participate in chemotaxis-type signalling in G. sulfurreducens and G. metallireducens.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S14.pdf]

Additional File 15
Figure S6. Predicted global regulator binding sites (class 4). This is an
alignment of 20 DNA sequences that were matched by nucleotide-level
BLAST. Each site appears to be based on a pentanucleotide repeat (consensus CCYTC) that occurs four times on one strand and twice on the
other. The sequence strand and start and stop nucleotide positions are
indicated.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S15.pdf]

Additional File 17
Table S10. Toxin/antitoxin pairs of G. metallireducens and G. sulfurreducens. This table compares the genes predicted to encode toxin/
antitoxin pairs in G. sulfurreducens and G. metallireducens.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S17.pdf]

Additional File 18
Table S11. The CRISPR3 locus of G. metallireducens contains spacers of variable length. The thirteen clustered regularly interspaced short
palindromic repeats (CRISPR) of G. metallireducens (consensus
sequence GTAGCGCCCGCCTACATAGGCGGGCGAGGATTGAAAC)
are far fewer than the thirty-eight of CRISPR1 and one hundred and
forty-three of CRISPR2 in G. sulfurreducens.
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S18.pdf]

Additional File 19
Figure S8. Miscellaneous multicopy nucleotide sequences found in the
G. metallireducens genome. These are alignments of 16 sets of miscellaneous DNA sequences in G. metallireducens that were matched by
nucleotide-level BLAST. The sequence strand and start and stop nucleotide positions are indicated. (a) A palindromic sequence-containing family also found in the genomes of G. sulfurreducens, G. uraniireducens,
and P. propionicus. (b) Sequences of this type were also found in the
genomes of G. sulfurreducens and G. uraniireducens. (c) These
sequences are unique to G. metallireducens. (d) The ends of these
sequences form inverted repeats. Each sequence begins at the left extremity
of the top line (the 5' side of the "+" strand of the chromosome), loops on
the right side (switching strands), and continues to the left extremity of
the bottom line (the 5' side of the "-" strand of the chromosome). A fragment related to Gmet_R6002 was found in the G. sulfurreducens
genome. (e) These sequences are unique to G. metallireducens. (f)
Sequences of this type were also found in the genomes of G. uraniireducens and G. bemidjiensis. (g) These sequences contain four octanucleotide repeats (consensus TWGTTGAY), two in tandem on each strand.
(h) Sequences of this type were also found in the genome of G. sulfurreducens. (i) These sequences are unique to G. metallireducens. (j) These
elements are located near each other. (k) These sequences are unique to
G. metallireducens. (l-p) These elements are located near each other.
Gmet_R0147 continues as Gmet_R0055, a tRNA-Asn gene (underlined).
Click here for file
[http://www.biomedcentral.com/content/supplementary/14712180-9-109-S19.pdf]

Page 18 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

http://www.biomedcentral.com/1471-2180/9/109

Acknowledgements

21.

We thank Maddalena Coppi, Jessica Butler, Ned Young, Mounir Izallalen
and Radhakrishnan Mahadevan for helpful discussions. We also thank Jose
F. Barbe and Marko Puljic for technical assistance. This research was supported by the Office of Science (Biological and Environmental Research),
U.S. Department of Energy (Grant No. DE-FC02-02ER63446).

22.
23.

References
1.
2.
3.
4.

5.
6.
7.
8.
9.
10.
11.
12.

13.
14.
15.

16.

17.
18.
19.
20.

Lovley DR: Dissimilatory Fe(III) and Mn(IV) reduction. Microbiol Rev 1991, 55:259-287.
Lovley DR, Holmes DE, Nevin KP: Dissimilatory Fe(III) and
Mn(IV) reduction. Adv Microb Physiol 2004, 49:219-286.
Lovley DR, Stolz JF, Nord GLJ, Phillips EJP: Anaerobic production
of magnetite by a dissimilatory iron-reducing microorganism. Nature 1987, 330:252-254.
Lovley DR, Phillips EJ: Novel mode of microbial energy metabolism: organic carbon oxidation coupled to dissimilatory
reduction of iron or manganese. Appl Environ Microbiol 1988,
54:1472-1480.
Lovley DR, Baedecker MJ, Lonergan DJ, Cozzarelli IM, Phillips EJP,
Siegel DI: Oxidation of aromatic contaminants coupled to
microbial iron reduction. Nature 1989, 339:297-299.
Lovley DR, Lonergan DJ: Anaerobic oxidation of toluene, phenol, and p-cresol by the dissimilatory iron-reducing organism, GS-15. Appl Environ Microbiol 1990, 56:1858-1864.
Lovley DR, Phillips EJP, Gorby YA, Landa ER: Microbial reduction
of uranium. Nature 1991, 350:413-416.
Lovley DR, Coates JD, Blunt-Harris EL, Phillips EJP, Woodward JC:
Humic substances as electron acceptors for microbial respiration. Nature (Letters) 1996, 382:445-447.
Childers SE, Ciufo S, Lovley DR: Geobacter metallireducens
accesses insoluble Fe(III) oxide by chemotaxis. Nature 2002,
416:767-769.
Bond DR, Holmes DE, Tender LM, Lovley DR: Electrode-reducing
microorganisms that harvest energy from marine sediments. Science 2002, 295:483-485.
Gregory KB, Bond DR, Lovley DR: Graphite electrodes as electron donors for anaerobic respiration. Environ Microbiol 2004,
6:596-604.
Methé BA, Nelson KE, Eisen JA, Paulsen IT, Nelson W, Heidelberg JF,
Wu D, Wu M, Ward N, Beanan MJ, Dodson RJ, Madupu R, Brinkac
LM, Daugherty SC, DeBoy RT, Durkin AS, Gwinn M, Kolonay JF, Sullivan SA, Haft DH, Selengut J, Davidsen TM, Zafar N, White O, Tran
B, Romero C, Forberger HA, Weidman J, Khouri H, Feldblyum TV,
Utterback TR, Van Aken SE, Lovley DR, Fraser CM: Genome of
Geobacter sulfurreducens: metal reduction in subsurface environments. Science 2003, 302:1967-1969.
Khan SA: Plasmid rolling-circle replication: highlights of two
decades of research. Plasmid 2005, 53:126-136.
Lovley DR, Chapelle FH: Deep subsurface microbial processes.
Rev Geophys 1995, 33:365-381.
Anderson RT, Vrionis HA, Ortiz-Bernad I, Resch CT, Long PE, Dayvault R, Karp K, Marutzky S, Metzler DR, Peacock A, White DC,
Lowe M, Lovley DR: Stimulating the in situ activity of Geobacter
species to remove uranium from the groundwater of a uranium-contaminated aquifer.
Appl Environ Microbiol 2003,
69:5884-5891.
Holmes DE, O'Neil RA, Vrionis HA, N'Guessan LA, Ortiz-Bernad I,
Larrahando MJ, Adams LA, Ward JA, Nicoll JS, Nevin KP, Chavan MA,
Johnson JP, Long PE, Lovley DR: Subsurface clade of Geobacteraceae that predominates in a diversity of Fe(III)-reducing
subsurface environments. ISME J 2007, 1:663-677.
Segura D, Mahadevan R, Juarez K, Lovley DR: Computational and
experimental analysis of redundancy in the central metabolism of Geobacter sulfurreducens . PLoS Comput Biol 2008, 4:e36.
Wolfe AJ: The acetate switch. Microbiol Mol Biol Rev 2005,
69:12-50.
Grundy FJ, Waters DA, Takova TY, Henkin TM: Identification of
genes involved in utilization of acetate and acetoin in Bacillus
subtilis . Mol Microbiol 1993, 10:259-271.
Gerhardt A, Cinkaya I, Linder D, Huisman G, Buckel W: Fermentation of 4-aminobutyrate by Clostridium aminobutyricum: cloning of two genes involved in the formation and dehydration
of 4-hydroxybutyryl-CoA. Arch Microbiol 2000, 174:189-199.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

Butler JE, He Q, Nevin KP, He Z, Zhou J, Lovley DR: Genomic and
microarray analysis of aromatics degradation in Geobacter
metallireducens and comparison to a Geobacter isolate from
a contaminated field site. BMC Genomics 2007, 8:180.
Peters F, Heintz D, Johannes J, van Dorsselaer A, Boll M: Genes,
enzymes, and regulation of para-cresol metabolism in Geobacter metallireducens . J Bacteriol 2007, 189:4729-4738.
Wischgoll S, Heintz D, Peters F, Erxleben A, Sarnighausen E, Reski R,
van Dorsselaer A, Boll M: Gene clusters involved in anaerobic
benzoate degradation of Geobacter metallireducens . Mol
Microbiol 2005, 58:1238-1252.
Caccavo F Jr, Lonergan DJ, Lovley DR, Davis M, Stolz JF, McInerney
MJ: Geobacter sulfurreducens sp. nov., a hydrogen- and acetate-oxidizing dissimilatory metal-reducing microorganism.
Appl Environ Microbiol 1994, 60:3752-3759.
Leuthner B, Heider J: Anaerobic toluene catabolism of Thauera
aromatica: the bbs operon codes for enzymes of beta oxidation of the intermediate benzylsuccinate. J Bacteriol 2000,
182:272-277.
Wischgoll S, Taubert M, Peters F, Jehmlich N, von Bergen M, Boll M:
Decarboxylating and non-decarboxylating glutaryl-CoA
dehydrogenases in the aromatic metabolism of obligately
anaerobic bacteria. J Bacteriol 2009.
Faivre-Nitschke SE, Couee I, Vermel M, Grienenberger J-M, Gualberto JM: Purification, characterization and cloning of isovaleryl-CoA dehydrogenase from higher plant mitochondria.
Eur J Biochem 2001, 268:1332-1339.
Huang KX, Huang S, Rudolph FB, Bennett GN: Identification and
characterization of a second butyrate kinase from Clostridium acetobutylicum ATCC 824. J Mol Microbiol Biotechnol 2000,
2:33-38.
Oultram JD, Burr ID, Elmore MJ, Minton NP: Cloning and
sequence analysis of the genes encoding phosphotransbutyrylase and butyrate kinase from Clostridium acetobutylicum
NCIMB 8052. Gene 1993, 131:107-112.
Bond DR, Mester T, Nesbo CL, Izquierdo-Lopez AV, Collart FL, Lovley DR: Characterization of citrate synthase from Geobacter
sulfurreducens and evidence for a family of citrate synthases
similar to those of eukaryotes throughout the Geobacteraceae. Appl Environ Microbiol 2005, 71:3858-3865.
Lovley DR, Giovannoni SJ, White DC, Champine JE, Phillips EJ, Gorby
YA, Goodwin S: Geobacter metallireducens gen. nov. sp. nov., a
microorganism capable of coupling the complete oxidation
of organic compounds to the reduction of iron and other
metals. Arch Microbiol 1993, 159:336-344.
Iwakura M, Tokushige M, Katsuki H: Studies on regulatory functions of malic enzymes. VII. Structural and functional characteristics of sulfhydryl groups in NADP-linked malic
enzyme from Escherichia coli W. J Biochem 1979, 86:1239-1249.
Lerondel G, Doan T, Zamboni N, Sauer U, Aymerich S: YtsJ has the
major physiological role of the four paralogous malic
enzyme isoforms in Bacillus subtilis .
J Bacteriol 2006,
188:4727-4736.
Tang YJ, Chakraborty R, Martin HG, Chu J, Hazen TC, Keasling JD:
Flux analysis of central metabolic pathways in Geobacter
metallireducens during reduction of soluble Fe(III)-nitrilotriacetic acid. Appl Environ Microbiol 2007, 73:3859-3864.
Butler JE, Glaven RH, Esteve-Nunez A, Nunez C, Shelobolina ES,
Bond DR, Lovley DR: Genetic characterization of a single
bifunctional enzyme for fumarate reduction and succinate
oxidation in Geobacter sulfurreducens and engineering of
fumarate reduction in Geobacter metallireducens. J Bacteriol
2006, 188:450-455.
Wood NJ, Alizadeh T, Richardson DJ, Ferguson SJ, Moir JW: Two
domains of a dual-function NarK protein are required for
nitrate uptake, the first step of denitrification in Paracoccus
pantotrophus . Mol Microbiol 2002, 44:157-170.
Lloyd JR, Leang C, Hodges Myerson AL, Coppi MV, Ciufo S, Methé B,
Sandler SJ, Lovley DR: Biochemical and genetic characterization of PpcA, a periplasmic c-type cytochrome in Geobacter
sulfurreducens. Biochem J 2003, 369:153-161.
Lovley DR, Fraga JL, Coates JD, Blunt-Harris EL: Humics as an electron donor for anaerobic respiration. Environ Microbiol 1999,
1:89-98.

Page 19 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

39.
40.

41.

42.

43.

44.

45.
46.
47.

48.

49.

50.

51.

52.

53.

54.

55.

56.

57.

Nohno T, Kasai Y, Saito T: Cloning and sequencing of the
Escherichia coli chlEN operon involved in molybdopterin biosynthesis. J Bacteriol 1988, 170:4097-4102.
Rivers SL, McNairn E, Blasco F, Giordano G, Boxer DH: Molecular
genetic analysis of the moa operon of Escherichia coli K-12
required for molybdenum cofactor biosynthesis. Mol Microbiol
1993, 8:1071-1081.
Robison K, McGuire AM, Church GM: A comprehensive library
of DNA-binding site matrices for 55 proteins applied to the
complete Escherichia coli K-12 genome. J Mol Biol 1998,
284:241-254.
Roth FP, Hughes JD, Estep PW, Church GM: Finding DNA regulatory motifs within unaligned noncoding sequences clustered
by whole-genome mRNA quantitation. Nat Biotechnol 1998,
16:939-945.
Yan B, Lovley DR, Krushkal J: Genome-wide similarity search for
transcription factors and their binding sites in a metal-reducing prokaryote Geobacter sulfurreducens . Biosystems 2007,
90:421-441.
Battchikova N, Koivulehto M, Denesyuk A, Ptitsyn L, Boretsky Y,
Hellman J, Korpela T: Aspartate aminotransferase from an
alkalophilic Bacillus contains an additional 20-amino acid
extension at its functionally important N-terminus. J Biochem
1996, 120:425-432.
Alfano JR, Kahn ML: Isolation and characterization of a gene
coding for a novel aspartate aminotransferase from Rhizobium meliloti . J Bacteriol 1993, 175:4186-4196.
Yoshida K, Fujita Y, Ehrlich SD: Three asparagine synthetase
genes of Bacillus subtilis . J Bacteriol 1999, 181:6081-6091.
Elmorjani K, Liotenberg S, Houmard J, de Marsac NT: Molecular
characterization of the gene encoding glutamine synthetase
in the cyanobacterium Calothrix sp. PCC 7601. Biochem Biophys Res Commun 1992, 189:1296-1302.
Curnow AW, Hong K, Yuan R, Kim S, Martins O, Winkler W, Henkin
TM, Soll D: Glu-tRNAGln amidotransferase: a novel heterotrimeric enzyme required for correct decoding of glutamine
codons during translation. Proc Natl Acad Sci USA 1997,
94:11819-11826.
Hoang TT, Williams S, Schweizer HP, Lam JS: Molecular genetic
analysis of the region containing the essential Pseudomonas
aeruginosa asd gene encoding aspartate-beta-semialdehyde
dehydrogenase. Microbiology 1997, 143:899-907.
Cirillo JD, Weisbrod TR, Pascopella L, Bloom BR, Jacobs WR Jr: Isolation and characterization of the aspartokinase and aspartate
semialdehyde
dehydrogenase
operon
from
mycobacteria. Mol Microbiol 1994, 11:629-639.
Singh SK, Yang K, Karthikeyan S, Huynh T, Zhang X, Phillips MA,
Zhang H: The thrH gene product of Pseudomonas aeruginosa is
a dual activity enzyme with a novel phosphoserine:homoserine phosphotransferase activity.
J Biol Chem 2004,
279:13166-13173.
Martin C, Cami B, Yeh P, Stragier P, Parsot C, Patte JC: Pseudomonas aeruginosa diaminopimelate decarboxylase: evolutionary relationship with other amino acid decarboxylases.
Mol Biol Evol 1988, 5:549-559.
Stragier P, Danos O, Patte JC: Regulation of diaminopimelate
decarboxylase synthesis in Escherichia coli. II. Nucleotide
sequence of the lysA gene and its regulatory region. J Mol Biol
1983, 168:321-331.
Hudson AO, Gilvarg C, Leustek T: Biochemical and phylogenetic
characterization of a novel diaminopimelate biosynthesis
pathway in prokaryotes identifies a diverged form of LLdiaminopimelate aminotransferase.
J Bacteriol 2008,
190:3256-3263.
Bourhy P, Martel A, Margarita D, Saint Girons I, Belfaiza J: Homoserine O-acetyltransferase, involved in the Leptospira meyeri
methionine biosynthetic pathway, is not feedback inhibited.
J Bacteriol 1997, 179:4396-4398.
Dobric N, Limsowtin GK, Hillier AJ, Dudman NP, Davidson BE: Identification and characterization of a cystathionine beta/
gamma-lyase from Lactococcus lactis ssp. cremoris MG1363.
FEMS Microbiol Lett 2000, 182:249-254.
Fernandez M, van Doesburg W, Rutten GA, Marugg JD, Alting AC,
van Kranenburg R, Kuipers OP: Molecular and functional analyses of the metC gene of Lactococcus lactis, encoding cystathionine beta-lyase. Appl Environ Microbiol 2000, 66:42-48.

http://www.biomedcentral.com/1471-2180/9/109

58.
59.

60.
61.

62.
63.

64.

65.

66.
67.

68.
69.

70.
71.

72.

73.

74.

75.

76.
77.
78.

Sie'nko M, Topczewski J, Paszewski A: Structure and regulation of
cysD, the homocysteine synthase gene of Aspergillus nidulans.
Curr Genet 1998, 33:136-144.
Yura T, Mori H, Nagai H, Nagata T, Ishihama A, Fujita N, Isono K,
Mizobuchi K, Nakata A: Systematic sequencing of the
Escherichia coli genome: analysis of the 0–2.4 min region.
Nucleic Acids Res 1992, 20:3305-3308.
Grundy FJ, Henkin TM: tRNA as a positive regulator of transcription antitermination in B. subtilis . Cell 1993, 74:475-482.
Shultz J, Hermodson MA, Garner CC, Herrmann KM: The nucleotide sequence of the aroF gene of Escherichia coli and the
amino acid sequence of the encoded protein, the tyrosinesensitive 3-deoxy-D-arabino-heptulosonate 7-phosphate
synthase. J Biol Chem 1984, 259:9655-9661.
Weaver LM, Herrmann KM: Cloning of an aroF allele encoding a
tyrosine-insensitive 3-deoxy-D-arabino-heptulosonate 7phosphate synthase. J Bacteriol 1990, 172:6581-6584.
Wu J, Howe DL, Woodard RW: Thermotoga maritima 3-deoxyD-arabino-heptulosonate 7-phosphate (DAHP) synthase:
the ancestral eubacterial DAHP synthase? J Biol Chem 2003,
278:27525-27531.
Fischer RS, Zhao G, Jensen RA: Cloning, sequencing, and expression of the P-protein gene (pheA) of Pseudomonas stutzeri in
Escherichia coli: implications for evolutionary relationships in
phenylalanine biosynthesis. J Gen Microbiol 1991, 137:1293-1301.
Shumilin IA, Bauerle R, Wu J, Woodard RW, Kretsinger RH: Crystal
structure of the reaction complex of 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase from Thermotoga maritima refines the catalytic mechanism and indicates a new
mechanism of allosteric regulation.
J Mol Biol 2004,
341:455-466.
Merkl R: Modelling the evolution of the archeal tryptophan
synthase. BMC Evolutionary Biology 2007, 7:59.
Hettwer S, Sterner R: A novel tryptophan synthase beta-subunit from the hyperthermophile Thermotoga maritima. Quaternary structure, steady-state kinetics, and putative
physiological role. J Biol Chem 2002, 277:8194-8201.
Kishan V, Hillen W: Molecular cloning, nucleotide sequence,
and promoter structure of the Acinetobacter calcoaceticus
trpFB operon. J Bacteriol 1990, 172:6151-6155.
Dosselaere F, Lambrecht M, Vanderleyden J: Isolation and
sequence analysis of the trpBA gene cluster, encoding tryptophan synthase, from Azospirillum brasilense. DNA Seq 2000,
11:287-293.
Deutch AH, Rushlow KE, Smith CJ: Analysis of the Escherichia coli
proBA locus by DNA and protein sequencing. Nucleic Acids Res
1984, 12:6337-6355.
Kwon DH, Lu CD, Walthall DA, Brown TM, Houghton JE, Abdelal
AT: Structure and regulation of the carAB operon in Pseudomonas aeruginosa and Pseudomonas stutzeri: no untranslated region exists. J Bacteriol 1994, 176:2532-2542.
Reynes JP, Tiraby M, Baron M, Drocourt D, Tiraby G: Escherichia
coli thymidylate kinase: molecular cloning, nucleotide
sequence, and genetic organization of the corresponding tmk
locus. J Bacteriol 1996, 178:2804-2812.
Marolewski A, Smith JM, Benkovic SJ: Cloning and characterization of a new purine biosynthetic enzyme: a non-folate glycinamide ribonucleotide transformylase from E. coli .
Biochemistry 1994, 33:2531-2537.
Smith JM, Daum HA 3rd: Identification and nucleotide sequence
of a gene encoding 5'-phosphoribosylglycinamide transformylase in Escherichia coli K12.
J Biol Chem 1987,
262:10565-10569.
Omumasaba CA, Okai N, Inui M, Yukawa H: Corynebacterium
glutamicum glyceraldehyde-3-phosphate dehydrogenase isoforms with opposite, ATP-dependent regulation. J Mol Microbiol Biotechnol 2004, 8:91-103.
Sproul AA, Lambourne LT, Jean-Jacques DJ, Kornberg HL: Genetic
control of manno(fructo)kinase activity in Escherichia coli .
Proc Natl Acad Sci USA 2001, 98:15257-15259.
De Troch P, Keijers V, Vanderleyden J: Sequence analysis of the
Azospirillum brasilense exoB gene, encoding UDP-glucose 4'epimerase. Gene 1994, 144:143-144.
Fernandez-Herrero LA, Badet-Denisot MA, Badet B, Berenguer J:
glmS of Thermus thermophilus HB8: an essential gene for cell-

Page 20 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

79.

80.

81.
82.

83.

84.

85.

86.

87.

88.
89.

90.

91.
92.
93.

94.
95.

96.

97.
98.

wall synthesis identified immediately upstream of the Slayer gene. Mol Microbiol 1995, 17:1-12.
Stevenson G, Andrianopoulos K, Hobbs M, Reeves PR: Organization of the Escherichia coli K-12 gene cluster responsible for
production of the extracellular polysaccharide colanic acid. J
Bacteriol 1996, 178:4885-4893.
Meier-Dieter U, Starman R, Barr K, Mayer H, Rick PD: Biosynthesis
of enterobacterial common antigen in Escherichia coli. Biochemical characterization of Tn10 insertion mutants defective in enterobacterial common antigen synthesis. J Biol Chem
1990, 265:13490-13497.
Namboori SC, Graham DE: Acetamido sugar biosynthesis in the
Euryarchaea. J Bacteriol 2008, 190:2987-2996.
Petruschka L, Adolf K, Burchhardt G, Dernedde J, Jurgensen J, Herrmann H: Analysis of the zwf-pgl-eda-operon in Pseudomonas
putida strains H and KT2440. FEMS Microbiol Lett 2002,
215:89-95.
Summers ML, Meeks JC, Chu S, Wolf RE Jr: Nucleotide sequence
of an operon in Nostoc sp. strain ATCC 29133 encoding four
genes of the oxidative pentose phosphate cycle. Plant Physiol
1995, 107:267-268.
Zamboni N, Fischer E, Laudert D, Aymerich S, Hohmann HP, Sauer
U: The Bacillus subtilis yqjI gene encodes the NADP+-dependent 6-P-gluconate dehydrogenase in the pentose phosphate
pathway. J Bacteriol 2004, 186:4528-4534.
Sorensen KI, Hove-Jensen B: Ribose catabolism of Escherichia
coli: characterization of the rpiB gene encoding ribose phosphate isomerase B and of the rpiR gene, which is involved in
regulation of rpiB expression. J Bacteriol 1996, 178:1003-1011.
Ma K, Adams MW: Sulfide dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus: a new multifunctional
enzyme involved in the reduction of elemental sulfur. J Bacteriol 1994, 176:6509-6517.
McIntyre HJ, Davies H, Hore TA, Miller SH, Dufour JP, Ronson CW:
Trehalose biosynthesis in Rhizobium leguminosarum bv. trifolii
and its role in desiccation tolerance. Appl Environ Microbiol 2007,
73:3984-3992.
Maruta K, Hattori K, Nakada T, Kubota M, Sugimoto T, Kurimoto M:
Cloning and sequencing of trehalose biosynthesis genes from
Arthrobacter sp. Q36. Biochim Biophys Acta 1996, 1289:10-13.
Pan YT, Carroll JD, Elbein AD: Trehalose-phosphate synthase of
Mycobacterium tuberculosis. Cloning, expression and properties of the recombinant enzyme.
Eur J Biochem 2002,
269:6091-6100.
Kaasen I, McDougall J, Strom AR: Analysis of the otsBA operon
for osmoregulatory trehalose synthesis in Escherichia coli and
homology of the OtsA and OtsB proteins to the yeast trehalose-6-phosphate synthase/phosphatase complex. Gene 1994,
145:9-15.
Butler JE, Kaufmann F, Coppi MV, Nunez C, Lovley DR: MacA, a
diheme c-type cytochrome involved in Fe(III) reduction by
Geobacter sulfurreducens. J Bacteriol 2004, 186:4042-4045.
Kim BC, Lovley DR: Investigation of direct vs. indirect involvement of the c-type cytochrome MacA in Fe(III) reduction by
Geobacter sulfurreducens. FEMS Microbiol Lett 2008, 286:39-44.
Shelobolina ES, Coppi MV, Korenevsky AA, DiDonato LN, Sullivan
SA, Konishi H, Xu H, Leang C, Butler JE, Kim BC, Lovley DR: Importance of c -type cytochromes for U(VI) reduction by Geobacter sulfurreducens. BMC Microbiol 2007, 7:16.
Leang C, Coppi MV, Lovley DR: OmcB, a c -type polyheme cytochrome, involved in Fe(III) reduction in Geobacter sulfurreducens. J Bacteriol 2003, 185:2096-2103.
Mehta T, Coppi MV, Childers SE, Lovley DR: Outer membrane c type cytochromes required for Fe(III) and Mn(IV) oxide
reduction in Geobacter sulfurreducens. Appl Environ Microbiol
2005, 71:8634-8641.
Kim BC, Leang C, Ding YH, Glaven RH, Coppi MV, Lovley DR:
OmcF, a putative c -type monoheme outer membrane cytochrome required for the expression of other outer membrane cytochromes in Geobacter sulfurreducens. J Bacteriol
2005, 187:4505-4513.
Dailey HA, Dailey TA: Protoporphyrinogen oxidase of Myxococcus xanthus. Expression, purification, and characterization of the cloned enzyme. J Biol Chem 1996, 271:8714-8718.
Sasarman A, Letowski J, Czaika G, Ramirez V, Nead MA, Jacobs JM,
Morais R: Nucleotide sequence of the hemG gene involved in

http://www.biomedcentral.com/1471-2180/9/109

99.
100.

101.
102.

103.
104.
105.
106.

107.

108.

109.

110.

111.

112.
113.

114.

115.

116.

117.
118.

the protoporphyrinogen oxidase activity of Escherichia coli
K12. Can J Microbiol 1993, 39:1155-1161.
Sun G, Sharkova E, Chesnut R, Birkey S, Duggan MF, Sorokin A, Pujic
P, Ehrlich SD, Hulett FM: Regulators of aerobic and anaerobic
respiration in Bacillus subtilis . J Bacteriol 1996, 178:1374-1385.
Lee JH, Harvat EM, Stevens JM, Ferguson SJ, Saier MH Jr: Evolutionary origins of members of a superfamily of integral membrane cytochrome c biogenesis proteins. Biochim Biophys Acta
2007, 1768:2164-2181.
Reguera G, McCarthy KD, Mehta T, Nicoll JS, Tuominen MT, Lovley
DR: Extracellular electron transfer via microbial nanowires.
Nature 2005, 435:1098-1101.
Reguera G, Nevin KP, Nicoll JS, Covalla SF, Woodard TL, Lovley DR:
Biofilm and nanowire production leads to increased current
in Geobacter sulfurreducens fuel cells. Appl Environ Microbiol 2006,
72:7345-7348.
Reguera G, Pollina RB, Nicoll JS, Lovley DR: Possible nonconductive role of Geobacter sulfurreducens pilus nanowires in biofilm formation. J Bacteriol 2007, 189:2125-2127.
Rudel T, Scheurerpflug I, Meyer TF: Neisseria PilC protein identified as type-4 pilus tip-located adhesin.
Nature 1995,
373:357-359.
Cartron ML, Maddocks S, Gillingham P, Craven CJ, Andrews SC: Feo
– transport of ferrous iron into bacteria. Biometals 2006,
19:143-157.
Dashper SG, Butler CA, Lissel JP, Paolini RA, Hoffmann B, Veith PD,
O'Brien-Simpson NM, Snelgrove SL, Tsiros JT, Reynolds EC: A novel
Porphyromonas gingivalis FeoB plays a role in manganese
accumulation. J Biol Chem 2005, 280:28095-28102.
Naikare H, Palyada K, Panciera R, Marlow D, Stintzi A: Major role
for FeoB in Campylobacter jejuni ferrous iron acquisition, gut
colonization, and intracellular survival. Infect Immun 2006,
74:5433-5444.
Schleyer M, Bakker EP: Nucleotide sequence and 3'-end deletion studies indicate that the K(+)-uptake protein kup from
Escherichia coli is composed of a hydrophobic core linked to
a large and partially essential hydrophilic C terminus. J Bacteriol 1993, 175:6925-6931.
Hesse JE, Wieczorek L, Altendorf K, Reicin AS, Dorus E, Epstein W:
Sequence homology between two membrane transport
ATPases, the Kdp-ATPase of Escherichia coli and the Ca2+ATPase of sarcoplasmic reticulum. Proc Natl Acad Sci USA 1984,
81:4746-4750.
Walderhaug MO, Polarek JW, Voelkner P, Daniel JM, Hesse JE, Altendorf K, Epstein W: KdpD and KdpE, proteins that control
expression of the kdpABC operon, are members of the twocomponent sensor-effector class of regulators. J Bacteriol 1992,
174:2152-2159.
Radchenko MV, Waditee R, Oshimi S, Fukuhara M, Takabe T, Nakamura T: Cloning, functional expression and primary characterization of Vibrio parahaemolyticus K+/H+ antiporter genes
in Escherichia coli. Mol Microbiol 2006, 59:651-663.
Bakker EP, Booth IR, Dinnbier U, Epstein W, Gajewska A: Evidence
for multiple K+ export systems in Escherichia coli . J Bacteriol
1987, 169:3743-3749.
Ito M, Guffanti AA, Oudega B, Krulwich TA: mrp, a multigene,
multifunctional locus in Bacillus subtilis with roles in resistance to cholate and to Na+ and in pH homeostasis. J Bacteriol
1999, 181:2394-2402.
Ghim SY, Neuhard J: The pyrimidine biosynthesis operon of the
thermophile Bacillus caldolyticus includes genes for uracil
phosphoribosyltransferase and uracil permease. J Bacteriol
1994, 176:3698-3707.
Cervantes C, Ohtake H, Chu L, Misra TK, Silver S: Cloning, nucleotide sequence, and expression of the chromate resistance
determinant of Pseudomonas aeruginosa plasmid pUM505. J
Bacteriol 1990, 172:287-291.
Sorokin A, Bolotin A, Purnelle B, Hilbert H, Lauber J, Dusterhoft A,
Ehrlich SD: Sequence of the Bacillus subtilis genome region in
the vicinity of the lev operon reveals two new extracytoplasmic function RNA polymerase sigma factors SigV and SigZ.
Microbiology 1997, 143(Pt 9):2939-2943.
Swinger KK, Rice PA: IHF and HU: flexible architects of bent
DNA. Curr Opin Structl Biol 2004, 14:28-35.
Pang H, Bartlam M, Zeng Q, Miyatake H, Hisano T, Miki K, Wong LL,
Gao GF, Rao Z: Crystal structure of human pirin: an iron-bind-

Page 21 of 22
(page number not for citation purposes)

BMC Microbiology 2009, 9:109

119.
120.
121.
122.

123.
124.

125.

126.
127.
128.
129.

http://www.biomedcentral.com/1471-2180/9/109

ing nuclear protein and transcription cofactor. J Biol Chem
2004, 279:1491-1498.
Wendler WM, Kremmer E, Forster R, Winnacker EL: Identification
of pirin, a novel highly conserved nuclear protein. J Biol Chem
1997, 272:8482-8489.
Sudarsan N, Lee ER, Weinberg Z, Moy RH, Kim JN, Link KH, Breaker
RR: Riboswitches in eubacteria sense the second messenger
cyclic di-GMP. Science 2008, 321:411-413.
Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau
S, Romero DA, Horvath P: CRISPR provides acquired resistance
against viruses in prokaryotes. Science 2007, 315:1709-1712.
Makarova K, Grishin N, Shabalina S, Wolf Y, Koonin E: A putative
RNA-interference-based immune system in prokaryotes:
computational analysis of the predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms of action. Biology Direct 2006, 1:7.
Griffiths-Jones S, Moxon S, Marshall M, Khanna A, Eddy SR, Bateman
A: Rfam: annotating non-coding RNAs in complete genomes.
Nucleic Acids Res 2005, 33:D121-124.
Berg OG, von Hippel PH: Selection of DNA binding sites by regulatory proteins. II. The binding specificity of cyclic AMP
receptor protein to recognition sites. J Mol Biol 1988,
200:709-723.
Salgado H, Gama-Castro S, Martinez-Antonio A, Diaz-Peredo E,
Sanchez-Solano F, Peralta-Gil M, Garcia-Alonso D, Jimenez-Jacinto V,
Santos-Zavaleta A, Bonavides-Martinez C, Collado-Vides J: RegulonDB (version 4.0): transcriptional regulation, operon
organization and growth conditions in Escherichia coli K-12.
Nucleic Acids Res 2004, 32:D303-306.
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local
alignment search tool. J Mol Biol 1990, 215:403-410.
Notredame C, Higgins DG, Heringa J: T-Coffee: A novel method
for fast and accurate multiple sequence alignment. J Mol Biol
2000, 302:205-217.
Maddison WP, Maddison DR: Mesquite: a modular system for
evolutionary analysis. Version 1.12. 2006.
Felsenstein J: PHYLIP (Phylogeny Inference Package) version
3.6. Distributed by the author. Department of Genome Sciences, University of Washington, Seattle. 2005.

Publish with Bio Med Central and every
scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical researc h in our lifetime."
Sir Paul Nurse, Cancer Research UK

Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours — you keep the copyright

BioMedcentral

Submit your manuscript here:
http://www.biomedcentral.com/info/publishing_adv.asp

Page 22 of 22
(page number not for citation purposes)

</pre>
</body>
</html>