Popular repositories Loading

1. DNA-Genetic-Python-Scripts-CTF DNA-Genetic-Python-Scripts-CTF Public

   a code written by me to decode the DNA Cipher (Genetic ) CTF challenge in which it is in the form of GAAACCACATATGATAAAACATAC

   Python 6 1

2. PhishX-New-Fix PhishX-New-Fix Public

   New Fixes for the PHISHX Phishing Tool

   Python 6 8

3. Redacted-Request Redacted-Request Public

   The "Redacted Request Extension" is a powerful tool designed to enhance the security and confidentiality of HTTP request handling within the Burp Suite.

   Python 3 1

4. SNMP-DoS SNMP-DoS Public

   SNMP GETBULK DoS

   Python 2

5. honeytrap honeytrap Public

   Forked from honeytrap/honeytrap

   Advanced Honeypot framework.

   Go 1

6. Project-Automation Project-Automation Public

   This Is a tool build in python for the automation of VAPT so feel free to contribute if any one wants to.

   Python 1