Skip to content

Commit

Permalink
Merge pull request #285 from jfy133/adapterremoval
Browse files Browse the repository at this point in the history
Add alternative trimmer: AdapterRemoval
  • Loading branch information
jfy133 authored Mar 24, 2022
2 parents 781c821 + ca0e475 commit 54e2455
Show file tree
Hide file tree
Showing 14 changed files with 357 additions and 34 deletions.
2 changes: 1 addition & 1 deletion .github/workflows/ci.yml
Original file line number Diff line number Diff line change
Expand Up @@ -55,7 +55,7 @@ jobs:
strategy:
matrix:
# Run remaining test profiles with minimum nextflow version
profile: [test_host_rm, test_hybrid, test_hybrid_host_rm, test_busco_auto, test_ancient_dna]
profile: [test_host_rm, test_hybrid, test_hybrid_host_rm, test_busco_auto, test_ancient_dna, test_adapterremoval]
steps:
- name: Check out pipeline code
uses: actions/checkout@v2
Expand Down
1 change: 1 addition & 0 deletions CHANGELOG.md
Original file line number Diff line number Diff line change
Expand Up @@ -10,6 +10,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0
- [#263](https://github.com/nf-core/mag/pull/263) - Restructure binning subworkflow in preparation for aDNA workflow and extended binning
- [#247](https://github.com/nf-core/mag/pull/247) - Add ancient DNA subworkflow
- [#263](https://github.com/nf-core/mag/pull/263) - Add MaxBin2 as second contig binning tool
- [#284](https://github.com/nf-core/mag/pull/285) - Add AdapterRemoval2 as an alternative read trimmer

### `Changed`

Expand Down
5 changes: 5 additions & 0 deletions assets/multiqc_config.yaml
Original file line number Diff line number Diff line change
Expand Up @@ -17,6 +17,8 @@ top_modules:
name: 'FastQC: raw reads'
path_filters_exclude:
- '*trimmed*'
- 'fastp'
- 'adapterRemoval':
- custom_content
- 'fastqc':
name: 'FastQC: after preprocessing'
Expand All @@ -42,6 +44,9 @@ custom_data:
sp:
host_removal:
fn: 'host_removal_metrics.tsv'
adapterRemoval:
fn: '*_ar2_*.log'

extra_fn_clean_exts:
- '.bowtie2'
- '_ar2'
33 changes: 32 additions & 1 deletion conf/modules.config
Original file line number Diff line number Diff line change
Expand Up @@ -34,7 +34,8 @@ process {
"-q ${params.fastp_qualified_quality}",
"--cut_front",
"--cut_tail",
"--cut_mean_quality ${params.fastp_cut_mean_quality}"
"--cut_mean_quality ${params.fastp_cut_mean_quality}",
"--length_required ${params.reads_minlength}"
].join(' ').trim()
publishDir = [
path: { "${params.outdir}/QC_shortreads/fastp/${meta.id}" },
Expand All @@ -43,6 +44,36 @@ process {
]
}

withName: ADAPTERREMOVAL_PE {
ext.args = [
"--minlength ${params.reads_minlength}",
"--adapter1 ${params.adapterremoval_adapter1} --adapter2 ${params.adapterremoval_adapter2}",
"--minquality ${params.adapterremoval_minquality} --trimns",
params.adapterremoval_trim_quality_stretch ? "--trim_qualities" : "--trimwindows 4"
].join(' ').trim()
publishDir = [
path: { "${params.outdir}/QC_shortreads/adapterremoval/${meta.id}" },
mode: 'copy',
pattern: "*.{log}"
]
ext.prefix = { "${meta.id}_ar2" }
}

withName: ADAPTERREMOVAL_SE {
ext.args = [
"--minlength ${params.reads_minlength}",
"--adapter1 ${params.adapterremoval_adapter1}",
"--minquality ${params.adapterremoval_minquality} --trimns",
params.adapterremoval_trim_quality_stretch ? "--trim_qualities" : "--trimwindows 4"
].join(' ').trim()
publishDir = [
path: { "${params.outdir}/QC_shortreads/adapterremoval/${meta.id}" },
mode: 'copy',
pattern: "*.{log}"
]
ext.prefix = { "${meta.id}_ar2" }
}

withName: BOWTIE2_PHIX_REMOVAL_ALIGN {
ext.suffix = "phix_removed"
publishDir = [
Expand Down
32 changes: 32 additions & 0 deletions conf/test_adapterremoval.config
Original file line number Diff line number Diff line change
@@ -0,0 +1,32 @@
/*
========================================================================================
Nextflow config file for running minimal tests
========================================================================================
Defines input files and everything required to run a fast and simple pipeline test.
Use as follows:
nextflow run nf-core/mag -profile test,<docker/singularity>
----------------------------------------------------------------------------------------
*/

params {
config_profile_name = 'Test profile for running with AdapterRemoval'
config_profile_description = 'Minimal test dataset to check pipeline function with AdapterRemoval data'

// Limit resources so that this can run on GitHub Actions
max_cpus = 2
max_memory = '6.GB'
max_time = '6.h'

// Input data
input = 'https://raw.githubusercontent.com/nf-core/test-datasets/mag/samplesheets/samplesheet.csv'
centrifuge_db = "https://raw.githubusercontent.com/nf-core/test-datasets/mag/test_data/minigut_cf.tar.gz"
kraken2_db = "https://raw.githubusercontent.com/nf-core/test-datasets/mag/test_data/minigut_kraken.tgz"
skip_krona = true
min_length_unbinned_contigs = 1
max_unbinned_contigs = 2
busco_reference = "https://busco-data.ezlab.org/v5/data/lineages/bacteria_odb10.2020-03-06.tar.gz"
gtdb = false
clip_tool = 'adapterremoval'
}
12 changes: 12 additions & 0 deletions docs/output.md
Original file line number Diff line number Diff line change
Expand Up @@ -57,6 +57,18 @@ FastQC is run for visualising the general quality metrics of the sequencing runs

</details>

### AdapterRemoval2

[AdapterRemoval](https://adapterremoval.readthedocs.io/en/stable/) searches for and removes remnant adapter sequences from High-Throughput Sequencing (HTS) data and (optionally) trims low quality bases from the 3' end of reads following adapter removal. It is popular in the field of palaeogenomics. The output logs are stored in the results folder, and as a part of the MultiQC report.

<details markdown="1">
<summary>Output files</summary>

* `QC_shortreads/adapterremoval/[sample]/`
* `[sample]_ar2.log`: AdapterRemoval log file (normally called `.settings` by AdapterRemoval.)

</details>

### Remove PhiX sequences from short reads

The pipeline uses bowtie2 to map the reads against PhiX and removes mapped reads.
Expand Down
3 changes: 3 additions & 0 deletions modules.json
Original file line number Diff line number Diff line change
Expand Up @@ -3,6 +3,9 @@
"homePage": "https://github.com/nf-core/mag",
"repos": {
"nf-core/modules": {
"adapterremoval": {
"git_sha": "f0800157544a82ae222931764483331a81812012"
},
"bcftools/consensus": {
"git_sha": "20d8250d9f39ddb05dfb437603aaf99b5c0b2b41"
},
Expand Down
8 changes: 4 additions & 4 deletions modules/local/multiqc.nf
Original file line number Diff line number Diff line change
@@ -1,21 +1,21 @@
process MULTIQC {
label 'process_medium'

conda (params.enable_conda ? "bioconda::multiqc=1.11" : null)
conda (params.enable_conda ? "bioconda::multiqc=1.12" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/multiqc:1.11--pyhdfd78af_0' :
'quay.io/biocontainers/multiqc:1.11--pyhdfd78af_0' }"
'https://depot.galaxyproject.org/singularity/multiqc:1.12--pyhdfd78af_0' :
'quay.io/biocontainers/multiqc:1.12--pyhdfd78af_0' }"

input:
path multiqc_files
path mqc_custom_config
path 'fastqc_raw/*'
path 'fastp/*'
path 'fastqc_trimmed/*'
path host_removal
path 'quast*/*'
path 'bowtie2log/*'
path short_summary
path additional

output:
path "*multiqc_report.html", emit: report
Expand Down
70 changes: 70 additions & 0 deletions modules/nf-core/modules/adapterremoval/main.nf

Some generated files are not rendered by default. Learn more about how customized files appear on GitHub.

90 changes: 90 additions & 0 deletions modules/nf-core/modules/adapterremoval/meta.yml

Some generated files are not rendered by default. Learn more about how customized files appear on GitHub.

14 changes: 11 additions & 3 deletions nextflow.config
Original file line number Diff line number Diff line change
Expand Up @@ -14,11 +14,17 @@ params {
single_end = false

// short read preprocessing options
save_trimmed_fail = false
clip_tool = 'fastp'
reads_minlength = 15
fastp_save_trimmed_fail = false
fastp_qualified_quality = 15
fastp_cut_mean_quality = 15
adapterremoval_minquality = 2
adapterremoval_adapter1 = 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG'
adapterremoval_adapter2 = 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT'
adapterremoval_trim_quality_stretch = false
keep_phix = false
// phix_reference = "ftp://ftp.ncbi.nlm.nih.gov/genomes/genbank/viral/Enterobacteria_phage_phiX174_sensu_lato/all_assembly_versions/GCA_002596845.1_ASM259684v1/GCA_002596845.1_ASM259684v1_genomic.fna.gz"
// phix_reference = "ftp://ftp.ncbi.nlm.nih.gov/genomes/genbank/viral/Enterobacteria_phage_phiX174_sensu_lato/all_assembly_versions/GCA_002596845.1_ASM259684v1/GCA_002596845.1_ASM259684v1_genomic.fna.gz"
phix_reference = "${baseDir}/assets/data/GCA_002596845.1_ASM259684v1_genomic.fna.gz"
host_fasta = null
host_genome = null
Expand Down Expand Up @@ -196,7 +202,9 @@ profiles {
test_hybrid_host_rm { includeConfig 'conf/test_hybrid_host_rm.config' }
test_busco_auto { includeConfig 'conf/test_busco_auto.config' }
test_full { includeConfig 'conf/test_full.config' }
test_ancient_dna { includeConfig 'conf/test_ancient_dna.config' }
test_ancient_dna { includeConfig 'conf/test_ancient_dna.config' }
test_adapterremoval { includeConfig 'conf/test_adapterremoval.config' }

}

// Load igenomes.config if required
Expand Down
Loading

0 comments on commit 54e2455

Please sign in to comment.