- Output files with detailed alert and error messages
- Explanation of sequence and model coordinate fields in
.altfiles toy50toy model used in examples of alert messages- Examples of different alert types and corresponding
.altoutput- Frameshift
- Large insertion
- Large deletion
- Mutated start codon
- Stop codon alerts
- Indefinite annotation at the start of a sequence or a feature
- Indefinite annotation at the end of a sequence or a feature
- Ambiguous nucleotides at the start of a sequence or a feature
- Ambiguous nucleotides at the end of a sequence or a feature
- Ambiguous nucleotides in start/stop codon that starts/ends with canonical nt
- Mature peptide-specific alerts
- Low similarity at the start of a sequence or a feature
- Low similarity at the end of a sequence or a feature
- Low similarity internal to a sequence or a feature
- Extra sequence at the start of a sequence
- Extra sequence at the end of a sequence
- Deleted feature
- Duplicate regions
- Discontinuous similarity
- Indefinite strand
- Low coverage
- Posterior probability annotation in VADR output Stockholm alignments
v-annotate.pl outputs two types of files with detailed alert/error
messages:
.altfiles.alt.listfiles- GenBank submission portal detailed error report
.tsvfiles
Documentation on the format of .alt files can be found
here and for .alt.list files can be found
here. The GenBank submission portal detailed
error report .tsv files are the same format as the .alt.list
files.
This page includes examples of many of the different alerts and
corresponding .alt file output below.
| alert code(s) | alert desc(s) | sequence coords description | model coords explanation | link to example |
|---|---|---|---|---|
| fsthicft, fsthicfi, fstlocft, fstlocfi, fstukcft, fstukcfi | POSSIBLE_FRAMESHIFT_HIGH_CONF, POSSIBLE_FRAMESHIFT_LOW_CONF, POSSIBLE_FRAMESHIFT | sequence positions of the frameshifted region | model (reference) positions of the frameshifted region, some nucleotides may be inserted before or after these positions | frameshift example |
| insertnn, insertnp | INSERTION_OF_NT | sequence positions of inserted nucleotides with respect to the model | model (reference) position after which insertion occurs (always length 1) | large insertion example |
| deletinn, deletinp | DELETION_OF_NT | sequence position just prior to (5' of) deletion with respect to the model (always length 1) | model (reference) positions that are deleted in sequence | large deletion example |
| mutstart | MUTATION_AT_START | sequence positions of predicted start codon (length <= 3) | model (reference) positions that align to the predicted start codon | mutated start codon example |
| mutendcd | MUTATION_AT_END | sequence positions of predicted stop codon (length <= 3) | model (reference) positions that align to the predicted stop codon | stop codon alert examples |
| mutendex | MUTATION_AT_END | sequence positions of 5'-most in-frame stop codon in the CDS, this stop codon will be 3' of expected stop codon position (always length 3) | model (reference) positions that align to stop codon in sequence coords |
stop codon alert examples |
| mutendns | MUTATION_AT_END | will be blank (-) |
will be blank (-) |
stop codon alert examples |
| unexleng | UNEXPECTED_LENGTH | sequence positions of the predicted CDS, the length of which is not a multiple of 3 | model (reference) positions that the predicted CDS align to, some nucleotides may be inserted before or after these positions | stop codon alert examples |
| cdsstopn | CDS_HAS_STOP_CODON | sequence positions of the 5'-most in-frame stop codon in the CDS, this stop will be 5' of expected stop codong position (always length 3) | model (reference) positions that align to stop codon in sequence coords |
stop codon alert examples |
| indf5gap | INDEFINITE_ANNOTATION_START | sequence position of first nucleotide aligned 3' of gap that aligns to the feature boundary (always length 1) | model (reference) position of the 5' feature boundary (always length 1) | stop codon alert examples |
| indf5lcc | INDEFINITE_ANNOTATION_START | sequence position of nucleotide aligned at the 5' feature boundary (always length 1) | model (reference) position of the 5' feature boundary (always length 1) | examples of indefinite annotation at start |
| indf5pst | INDEFINITE_ANNOTATION_START | sequence positions of the nucleotide alignment of the 5' end of the CDS not covered by the protein-based alignment | model (reference) position of the 5' boundary of the CDS (always length 1) | examples of indefinite annotation at start |
| indf5plg | INDEFINITE_ANNOTATION_START | sequence positions of the protein-based alignment not covered by the nucleotide alignment at the 5' end of the CDS | model (reference) position of the 5' boundary of the CDS (always length 1) | examples of indefinite annotation at start |
| indf3gap | INDEFINITE_ANNOTATION_END | sequence position of final nucleotide aligned 5' of gap that aligns to the feature boundary (always length 1) | model (reference) position of the 3' feature boundary (always length 1) | examples of indefinite annotation at end |
| indf3lcc | INDEFINITE_ANNOTATION_START | sequence position of nucleotide aligned at the 3' feature boundary (always length 1) | model (reference) position of the 3' feature boundary (always length 1) | examples of indefinite annotation at end |
| indf3pst | INDEFINITE_ANNOTATION_START | sequence positions of the nucleotide alignment of the 3' end of the CDS not covered by the protein-based alignment | model (reference) position of the 3' boundary of the CDS (always length 1) | examples of indefinite annotation at end |
| indf3plg | INDEFINITE_ANNOTATION_START | sequence positions of the protein-based alignment not covered by the nucleotide alignment at the 3' end of the CDS | model (reference) position of the 3' boundary of the CDS (always length 1) | examples of indefinite annotation at end |
| ambgnt5f, ambgnt5c | AMBIGUITY_AT_FEATURE_START, AMBIGUITY_AT_CDS_START | sequence position(s) of stretch of 1 or more consecutive ambiguous (non-ACGTU) nts ending at the 3' end of a feature | model (reference) position(s) the sequence position(s) in sequence coords are aligned to |
examples of ambiguous nucleotides at start |
| ambgnt5s | AMBIGUITY_AT_END | sequence position(s) of 1 or more consecutive ambiguous (non-ACGTU) nts starting at position 1 of the sequence | model (reference) position(s) the sequence position(s) in sequence coords are aligned to |
examples of ambiguous nucleotides at start |
| ambgnt3f, ambgnt3c | AMBIGUITY_AT_FEATURE_END, AMBIGUITY_AT_CDS_END | sequence position(s) of 1 or more consecutive ambiguous (non-ACGTU) nts starting at the predicted 5' end of a feature | model (reference) position(s) the sequence position(s) in sequence coords are aligned to |
examples of ambiguous nucleotides at end |
| ambgnt3s | AMBIGUITY_AT_END | sequence position(s) of 1 or more consecutive ambiguous (non-ACGTU) nts ending at the final position of the sequence | model (reference) position(s) the sequence position(s) in sequence coords are aligned to |
examples of ambiguous nucleotides at end |
| ambgcd5c | AMBIGUITY_IN_START_CODON | sequence position(s) of start codon | model (reference) position(s) the sequence position(s) in sequence coords are aligned to |
examples of ambiguous nucleotides in start/stop codons |
| ambgcd3c | AMBIGUITY_IN_STOP_CODON | sequence position(s) of stop codon | model (reference) position(s) the sequence position(s) in sequence coords are aligned to |
examples of ambiguous nucleotides in start/stop codons |
| pepadjcy | PEPTIDE_ADJACENCY_PROBLEM | sequence position(s) of nucleotides inserted between two mature peptide predictions that are expected to be adjacent | model (reference) position(s) corresponding to the end of the 5' mature peptide and the start of the 3' mature peptide (always length 2) | mature peptide-specific alert examples |
| peptrans | PEPTIDE_TRANSLATION_PROBLEM | will be blank (-) |
will be blank (-) |
mature peptide-specific alert examples |
| lowsim5c, lowsim5n, lowsim5l | LOW_FEATURE_SIMILARITY_START | sequence position(s) at 5' end of sequence that have low similarity to the reference model (low similarity region overlaps with a predicted feature) | model (reference) position(s) the sequence position(s) in sequence coords are aligned to |
examples of low similarity at start |
| lowsim5s | LOW_SIMILARITY_START | sequence position(s) at 5' end of sequence (not overlapping with a feature) that have low similarity to the reference model | model (reference) position(s) the sequence position(s) in sequence coords are aligned to, or '-' if sequence is not aligned |
examples of low similarity at start |
| lowsim3c, lowsim3n, lowsim3l | LOW_FEATURE_SIMILARITY_END | sequence position(s) at 3' end of sequence that have low similarity to the reference model (low similarity region overlaps with a predicted feature) | model (reference) position(s) the sequence position(s) in sequence coords are aligned to |
examples of low similarity at end |
| lowsim3s | LOW_SIMILARITY_END | sequence position(s) at 3' end of sequence (not overlapping with a feature) that have low similarity to the reference model | model (reference) position(s) the sequence position(s) in sequence coords are aligned to, or '-' if sequence is not aligned |
examples of low similarity at end |
| lowsimic, lowsimin, lowsimil | LOW_FEATURE_SIMILARITY | sequence position(s) internal to a predicted feature (not including first or final position of the feature) that have low similarity to the reference model | model (reference) position(s) the sequence position(s) in sequence coords are aligned to |
examples of internal low similarity |
| lowsimis | LOW_SIMILARITY | sequence position(s) internal to a sequence (not including first or final position of the sequence) and not overlapping with a feature that have low similarity to the reference model | model (reference) position(s) the sequence position(s) in sequence coords are aligned to, or '-' if sequence is not aligned |
examples of internal low similarity |
| extrant5 | EXTRA_SEQUENCE_START | sequence position(s) at 5' end of sequence predicted to come before the first position of the reference model | always 0..0:+ |
examples of extra sequence at start |
| extrant3 | EXTRA_SEQUENCE_END | sequence position(s) at 3' end of sequence predicted to come after the final position of the reference model | always L..L:+, where L is the length of the reference model |
examples of extra sequence at end |
| deletins | DELETION_OF_FEATURE | will be blank (-) |
model (reference) positions that correspond to the feature that is deleted in the sequence | deleted feature examples |
| deletinf | DELETION_OF_FEATURE_SECTION | will be blank (-) |
model (reference) positions that correspond to the segment of the feature that is deleted in the sequence | deleted features examples |
| dupregin | DUPLICATE_REGIONS | N sets of sequence coordinates, in pairs, each pair is two hits that overlap in model coordinates, N will be a factor of 2 | N model (reference) coordinates, one for each of the hits in the coverage determination stage that correspond to each set of sequence coordinates 1 to N | duplicate regions example |
| discontn | DISCONTINUOUS_SIMILARITY | N sets of sequence coordinates, one for each hit in the coverage determination stage | N model (reference) coordinates, one for each of the hits in the coverage determination stage that correspond to each set of sequence coordinates 1 to N | discontinuous similarity example |
| indfstrn | INDEFINITE_STRAND | sequence coordinates of the best hit on the opposite strand from the overall best hit for this sequence in the coverage determination stage | model (reference) coordinates for the hit pertaining to the sequence coordinates in sequence coords |
indefinite strand example |
| lowcovrg | LOW_COVERAGE | one or more set of sequence coordinates that are not covered by any hit to the model on the top-scoring strand in the coverage determination stage | will be blank (-) |
low coverage example |
The toy50 model is a toy example used to illustrate many of the
problems with sequences that VADR can detect using simple examples on
this page. The toy50 model is 50 nucleotides long and includes 1 CDS
feature from positions 11 to 31 with the name (product) of protein one . That CDS is composed of two adjacent mature peptides: protein one mp1 from positions 11 to 22 and protein one mp2 from positions
23 to 28. The final 3 nucleotides of the CDS, 29 to 31, are the stop
codon. The model info file for the toy50 model is shown below.
MODEL toy50 cmfile:"toy50.cm" group:"toy" length:"50" subgroup:"A" blastdb:"toy50.protein.fa"
FEATURE toy50 type:"CDS" coords:"11..31:+" parent_idx_str:"GBNULL" gene:"one" product:"protein one"
FEATURE toy50 type:"mat_peptide" coords:"11..22:+" parent_idx_str:"0" product:"protein one mp1"
FEATURE toy50 type:"mat_peptide" coords:"23..28:+" parent_idx_str:"0" product:"protein one mp2"
The reference sequence for the toy50 model is shown below, as a
Stockholm format alignment file (even though it has one sequence)
with special markup in the form of #=GC columns to show where the
CDS and mature peptide features are, as well as the sequence position
information:
# STOCKHOLM 1.0
toy50 GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC CDS1.11..31:+ ..........123123123123123123stp...................
#=GC MP1.11..22:+ ..........123123123123............................
#=GC MP2.23..28:+ ......................123123......................
#=GC COLX. 00000000011111111112222222222333333333344444444445
#=GC COL.X 12345678901234567890123456789012345678901234567890
//
Stockholm format is described in more detail at https://en.wikipedia.org/wiki/Stockholm_format and http://eddylab.org/infernal/Userguide.pdf (section 9: "File and output formats")
| relevant alert codes | corresponding alert descriptions | notes |
|---|---|---|
| fsthicft, fsthicfi | POSSIBLE_FRAMESHIFT_HIGH_CONF | only possible if --glsearch is not used |
| fstlocft, fstlocfi | POSSIBLE_FRAMESHIFT_LOW_CONF | only possible if --glsearch is not used |
| fstukcft, fstukcfi | POSSIBLE_FRAMESHIFT | only possible if --glsearch is used |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-frameshift.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-frameshift/va-example-frameshift.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ----------- --------------- --- -------- ---- ----------------------------- -------- --- -------- --- ------
1.1.2 TOY50-FS1 toy50 CDS protein_one 1 fsthicfi yes POSSIBLE_FRAMESHIFT_HIGH_CONF 13..25:+ 13 14..23:+ 10 high confidence possible frameshift in CDS (frame restored before end) [cause:insert,S:13..17(5),M:13; restore:delete,S:25,M:22..23(2); frame:1(3)1; length:3:(13):8; shifted_avgpp:0.825; exp_avgpp:0.892;]
Alignment of TOY50-FS1 sequence to the toy50 model: The output file
va-example-frameshift/va-example-frameshift.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the frameshift, as explained more below.
The #=GC RF line shows the toy50 reference model sequence.
The #=GR PP line indicates confidence estimates for each aligned
nucleotide as explained more here.
This alignment is only output when the --keep or
--out_stk options are used with v-annotate.pl.
TOY50-FS1 -AAATCACCGATGcccccGTGATCGC--TACCATAAATGAGCATTCTACGTGCAT
#=GR TOY50-FS1 PP .**********987777789***998..59*************************
#=GC SS_cons :::::::::::::.....:::::::::::::::::::::::::::::::::::::
#=GC RF GAAATCACCGATG.....GTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 0000000001111.....1111112222222222333333333344444444445
#=GC RFCOL.X 1234567890123.....4567890123456789012345678901234567890
How to interpret this alert based on the above output:
As reported in the .alt file and .alt.list files as shown above, a
possible frameshift exists in the CDS named protein one in the
sequence named TOY50-FS1 which matches best to the model named
toy50. The .alt file contains details on the frameshift. The
frameshifted region is sequence positions 13 to 25 (seq coords: 13..25:+ in the .alt file) which is aligned to the reference model
positions 14 to 23 (mdl coords: 14..23:+).
The alert detail field provides further information:
the indels that "cause" the frameshifted region are an insertion of length 5 of nucleotides
13 to 17 after model position 13 (cause:insert,S:13..17(5),M:13;).
The mutation that restores the frame is a deletion of length 2 after nucleotide 25 corresponding to model
positions 22 and 23 (restore:delete:S:25,M:22..23(2);).
The CDS starts in frame 1 for 3 nt, shifts into frame 3 for the frameshifted region
for 13 nt and restores to frame 1 for 8 nt before the end of the CDS (frame:1(3)1 and
length:3:(13):8). The table below show how to interpret different frame and length
strings. The frame that the CDS starts in is defined as the
'expected frame' (this will always be 1 unless the CDS is truncated
at the 5' end).
This frameshift is a high confidence
frameshift in that the average posterior probability of the aligned
nucleotides in the frameshifted region is 0.825
(shifted_frame:0.825) and of the expected region prior to (5' of) the
frameshift is 0.892 (exp_frame:0.892) both of which exceed the
threshold for high confidence (0.8 by default). (The PP of both
the shifted and expected regions must exceed the high confidence threshold for a frameshift
to be defined as high confidence.) Other possible
frameshifts with lower posterior probability values will be reported
with the POSSIBLE_FRAMESHIFT_LOW_CONF error. If the --glsearch
option is used with v-annotate.pl, as is recommended with
SARS-CoV-2 analysis, posterior probability values are
not calculated and so all frameshifts are reported with the
POSSIBLE_FRAMESHIFT error.
A separate alignment file showing the CDS features that include
possible frameshifts can be optionally output from v-annotate.pl
using the --out_fsstk option. An example excerpt from such an
alignment file for this possible frameshift is below (see
va-example-frameshift/va-exammle-frameshift.vadr.toy50.CDS.1.1.frameshift.stk). The
#=GR PP shows an estimate of the posterior probability of each
aligned nucleotide as explained more here. The #=GR CS
line shows the implied frame of each aligned nucleotide and have i
for inserted nucleotides and d for deleted reference
positions. The #=GC RF line shows the reference model sequence.
TOY50-FS1 ATGCCCCCGTGATCGC--TACCATAA
#=GR TOY50-FS1 PP *987777789***998..59******
#=GR TOY50-FS1 CS 111iiiii33333333dd11111111
#=GC SS_cons ::::::::::::::::::::::::::
#=GC RF ATG.....GTGATCGCTTTACCATAA
#=GC RFCOLX. 111.....111111222222222233
#=GC RFCOL.X 123.....456789012345678901
| frame string | ......length_string...... | 5' truncated? | 3' truncated? | frame of shifted region | explanation |
|---|---|---|---|---|---|
1(2) |
10:(50) |
no | no | 2 | frame 1 for 10 nt, frame 2 for 50 nt |
<1(2) |
10:(50) |
yes | no | 2 | frame 1 for 10 nt, frame 2 for 50 nt |
<1(2)> |
10:(50) |
yes | yes | 2 | frame 1 for 10 nt, frame 2 for 50 nt |
1(23)131> |
10:(50:30)20:9:31 |
no | yes | 2 then 3 | frame 1 for 10 nt, frame 2 for 50 nt, frame 3 for 30 nt, frame 1 for 20 nt, frame 3 for 9 nt, frame 1 for 31 nt |
| relevant alert codes | corresponding alert descriptions |
|---|---|
| insertnn, insertnp | INSERTION_OF_NT |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-insert.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-insert/va-example-insert.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- -------- ----- ---- ----------- --- -------- ---- --------------- -------- --- -------- --- ------
1.1.1 TOY50-I1 toy50 CDS protein_one 1 insertnn no INSERTION_OF_NT 23..28:+ 6 23..23:+ 1 too large of an insertion in nucleotide-based alignment of CDS feature [6>2]
Alignment of TOY50-I1 sequence to the toy50 model: The output file
va-example-insert/va-example-insert.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the insertion, as explained more below.
The #=GC RF line shows the toy50 reference model sequence.
The #=GR PP line indicates confidence estimates for each aligned
nucleotide as explained more here.
This alignment is only output when the --keep or
--out_stk options are used with v-annotate.pl.
TOY50-I1 -AAATCACCGATGGTGATCGCTTggggggTACCATAAATGAGCATTCTACGTGCAT
#=GR TOY50-I1 PP .********************9866666689*************************
#=GC SS_cons :::::::::::::::::::::::......:::::::::::::::::::::::::::
#=GC RF GAAATCACCGATGGTGATCGCTT......TACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 00000000011111111112222......222222333333333344444444445
#=GC RFCOL.X 12345678901234567890123......456789012345678901234567890
//
How to interpret this alert based on the above output: As
reported in the .alt file shown above, in the CDS feature with
name protein one, the nucleotides 23 to 28, length 6, (seq coords:23..28:+, seq len:6) on the + strand insert after
reference model position 23 (mdl coords:23..23:+). This length
exceeds the minimum allowed length of 2 (set with the
v-annotate.pl option --nmaxins 2 option for purposes of this
example, alert detail:[6>2]). You can see the gggggg insertion after model position 23
in the above alignment.
The insertnn alert is detected in the nucleotide alignment stage.
A similar insertnp alert can be reported for insertions detected in the
protein validation stage, and often you will see both alerts for the
same insertion.
| relevant alert codes | corresponding alert descriptions |
|---|---|
| deletinn, deletinp | DELETION_OF_NT |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-delete.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-delete/va-example-delete.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- -------- ----- ---- ----------- --- -------- ---- -------------- -------- --- -------- --- ------
1.1.1 TOY50-D1 toy50 CDS protein_one 1 deletinn no DELETION_OF_NT 15..15:+ 1 17..19:+ 3 too large of a deletion in nucleotide-based alignment of CDS feature [3>2]
Alignment of TOY50-D1 sequence to the toy50 model: The output file
va-example-delete/va-example-delete.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the deletion, as explained more below.
The #=GC RF line shows the toy50 reference model sequence.
The #=GR PP line indicates confidence estimates for each aligned
nucleotide as explained more here.
This alignment is only output when the --keep or
--out_stk options are used with v-annotate.pl.
TOY50-D1 -AAATCACCGATGGTG---GCTTTACCATAAATGAGCATTCTACGTGCAT
#=GR TOY50-D1 PP .***********9987...89*****************************
#=GC SS_cons ::::::::::::::::::::::::::::::::::::::::::::::::::
#=GC RF GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 00000000011111111112222222222333333333344444444445
#=GC RFCOL.X 12345678901234567890123456789012345678901234567890
//
How to interpret this alert based on the above output:
As reported in the .alt file shown above,
in the CDS feature with name protein one, the reference model
positions 17 to 19, length 3 (mdl coords:17..19:+, mdl len:3) are deleted in the sequence TOY50-D1. The
deletion occurs after position 15 (seq coords:15..15:+) in the sequence.
The deletion length of 3 exceeds the minimum allowed length of 2 (set with the
v-annotate.pl option --nmaxdel 2 option for purposes of this
example, alert detail:[3>2]). You can see the three deleted positions (---) in model
RF positions 17 to 19 in the above alignment.
The deletinn alert is detected in the nucleotide alignment stage.
A similar deletnp alert can be reported for deletions detected in the
protein validation stage, and often you will see both alerts for the
same deletion.
| relevant alert code | corresponding alert description |
|---|---|
| mutstart | MUTATION_AT_START |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-start.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-start/va-example-start.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- -------- ----- ----------- ----------- --- -------- ---- ---------------- -------- --- -------- --- ------
1.1.1 TOY50-S1 toy50 CDS protein_one 1 mutstart yes MUTATION_AT_START 10..12:+ 3 11..13:+ 3 expected start codon could not be identified [ATT]
Alignment of TOY50-S1 sequence to the toy50 model: The output
file va-example-start/va-example-start.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, allows
you to see the alignment of the predicted start codon and
surrounding sequence. The #=GC RF line
shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
vvv
TOY50-S1 -AAATCACCGATTGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GR TOY50-S1 PP .*************************************************
#=GC SS_cons ::::::::::::::::::::::::::::::::::::::::::::::::::
#=GC RF GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 00000000011111111112222222222333333333344444444445
#=GC RFCOL.X 12345678901234567890123456789012345678901234567890
How to interpret this alert based on the above output: The first
three nucleotides of any CDS feature that is not truncated on the 5'
end are checked to see if they are a valid start codon, and if not,
the mutstart alert is reported. For this specific example, as
reported in the .alt file shown above, the CDS start codon is from
model (reference) positions 11 to 13 (mdl coords:11..13:+), and the first 3 nucleotides of
the predicted CDS are positions 10 to 12 (seq coords:10..12:+). The predicted invalid
ATT start codon (alert detail:[ATT]) can be seen in the above alignment, marked by the
vvv characters at the top of the alignment. (These vvv
characters have been added here, and do not exist in the actual
output alignment file.)
| relevant alert codes | corresponding alert descriptions |
|---|---|
| mutendcd, mutendns, mutendex | MUTATION_AT_END |
| cdsstopn, cdsstopp | CDS_HAS_STOP_CODON |
| unexleng | UNEXPECTED_LENGTH |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-stop.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-stop/va-example-stop.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ---- ----------- --- -------- ---- ------------------- -------- --- -------- --- ------
1.1.1 TOY50-SP1 toy50 CDS protein_one 1 mutendcd yes MUTATION_AT_END 28..30:+ 3 29..31:+ 3 expected stop codon could not be identified, predicted CDS stop by homology is invalid [TAC]
1.1.2 TOY50-SP1 toy50 CDS protein_one 1 mutendns yes MUTATION_AT_END - - - - expected stop codon could not be identified, no in-frame stop codon exists 3' of predicted start codon [-]
#
2.1.1 TOY50-SP2 toy50 CDS protein_one 1 mutendcd yes MUTATION_AT_END 27..29:+ 3 28..30:+ 3 expected stop codon could not be identified, predicted CDS stop by homology is invalid [ATA]
2.1.2 TOY50-SP2 toy50 CDS protein_one 1 mutendex yes MUTATION_AT_END 31..33:+ 3 33..35:+ 3 expected stop codon could not be identified, first in-frame stop codon exists 3' of predicted stop position [TGA]
2.1.3 TOY50-SP2 toy50 CDS protein_one 1 unexleng yes UNEXPECTED_LENGTH 10..29:+ 20 11..30:+ 20 length of complete coding (CDS or mat_peptide) feature is not a multiple of 3 [20]
#
3.1.1 TOY50-SP3 toy50 CDS protein_one 1 mutendcd yes MUTATION_AT_END 28..30:+ 3 29..31:+ 3 expected stop codon could not be identified, predicted CDS stop by homology is invalid [TAC]
3.1.2 TOY50-SP3 toy50 CDS protein_one 1 cdsstopn yes CDS_HAS_STOP_CODON 22..24:+ 3 23..25:+ 3 in-frame stop codon exists 5' of stop position predicted by homology to reference [TAA, shifted S:6,M:6]
Alignment of TOY50-SP1, TOY50-SP2 and TOY50-SP3 sequences to the toy50 model: The output
file va-example-stop/va-example-stop.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the stop-codon related alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
vvv
TOY50-SP1 -AAATCACCGATGGTGATCGCTTTACCATACATGAGCATTCTACGTGCAT
#=GR TOY50-SP1 PP .*************************************************
TOY50-SP2 -AAATCACCGATGGTGATCGCTTTACCATA-CTGAGCATTCTACGTGCAT
#=GR TOY50-SP2 PP .***************************96.69*****************
TOY50-SP3 -AAATCACCGATGGTGATCGCTTAACCATACATGAGCATTCTACGTGCAT
#=GR TOY50-SP3 PP .*************************************************
#=GC SS_cons ::::::::::::::::::::::::::::::::::::::::::::::::::
#=GC RF GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 00000000011111111112222222222333333333344444444445
#=GC RFCOL.X 12345678901234567890123456789012345678901234567890
^^^
How to interpret this alert based on the above output: Several checks are made on CDS features related to stop codons and these three sequences demonstrate failures of some of these checks.
TOY50-SP1sequence:
The mutendcd alert with description MUTATION_AT_END is reported
because it has an invalid stop codon TAC (alert detail:[TAC]) at positions 28 to 30
(seq coords:28..30:+) which are aligned to model positions 29 to 31 (mdl coords:29..31:+, marked by vvv
characters in the alignment above), which are the final three
positions of the predicted protein one CDS feature. The mutendns
alert with description MUTATION_AT_END is also reported because no
valid in-frame stop codon (in the same frame as the predicted start
codon) exists in the remainder of the sequence.
TOY50-SP2sequence:
The mutendcd alert with description MUTATION_AT_END is
reported because it has an invalid stop codon ATA (alert detail:[ATA]) at positions 27 to 29 (seq coords:27..29:+) which are aligned to model positions 28
to 30 (mdl coords:28..30:+), which are the final 3 positions of the predicted protein one
CDS feature. Unlike TOY50-SP1, there is an in-frame valid TGA stop codon
3' of the expected stop position (alert detail:[TGA]), at sequence positions 31 to 33 (seq coords:31..33:+) which
align to model positions 33 to 35 (mdl coords:33..35:+), which cause a mutendex alert with
description MUTATION_AT_END to be reported. Finally, because the predicted CDS feature
is length 20 (alert detail:[20]), from sequence positions 10 to 29 (seq coords:10..29:+) aligned to model positions
11 to 30 (mdl coords:11..30:+), and 20 is not a multiple of 3, the unexleng alert with description
UNEXPECTED_LENGTH is reported.
TOY50-SP3sequence:
Like TOY50-SP1, the mutendcd alert with description MUTATION_AT_END is
reported because it has an invalid stop
codon TAC (alert detail:[TAC]) at positions 28 to 30 (seq coords:28..30:+) which are aligned to model positions 29
to 31 (mdl coords:29..31:+), which are the final three positions of the predicted protein one
CDS feature. Unlike the other two sequences, there is an in-frame valid TAA
stop codon 5' of the expected stop position (alert detail:[TAA), at sequence positions 22 to 24 (seq coords:22..24:+)
which align to model positions 23 to 25 (mdl coords:23..25:+, marked by ^^^ characters at the
bottom of the alignment above), which causes a cdsstopn alert with
description CDS_HAS_STOP_CODON. The early stop codon shifts the stop codon 6 positions in the
sequence and the reference relative to the expected stop position (alert detail:shifted S:6,M:6).
The cdsstopn alert is detected based on the nucleotide alignment.
A similar cdsstopp alert with description CDS_HAS_STOP_CODON is
reported when early in-frame stop codons are detected in the protein validation
stage by blastx. Often you will see both alerts for the same early stop codon,
but sometimes you will only see one or the other.
| relevant alert codes | corresponding alert descriptions |
|---|---|
| indf5gap, indf5lcc, indf5pst*, indf5lcn (not shown), indf5plg (not shown) | INDEFINITE_ANNOTATION_START |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-indefstart.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-indefstart/va-example-indefstart.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ---- ----------- --- -------- ---- --------------------------- -------- --- -------- --- ------
1.1.4 TOY50-IS1 toy50 CDS protein_one 1 indf5gap yes INDEFINITE_ANNOTATION_START 10..10:+ 1 11..11:+ 1 alignment to homology model is a gap at 5' boundary [-]
#
2.1.1 TOY50-IS2 toy50 CDS protein_one 1 indf5lcc no INDEFINITE_ANNOTATION_START 8..8:+ 1 11..11:+ 1 alignment to homology model has low confidence at 5' boundary for feature that is or matches a CDS [0.80<0.90]
Alignment of TOY50-IS1 and TOY50-IS2 sequences to the toy50 model: The output
file va-example-indefstart/va-example-indefstart.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
v
TOY50-IS1 -AAATCACCG-TGGTGATCGCTTTACCATAAATGAGCAT-----------
#=GR TOY50-IS1 PP .*******98.89**************************...........
TOY50-IS2 -AAATCAC--ATGGTGATCGCTTTACCATAAATGAGCAT-----------
#=GR TOY50-IS2 PP .*****98..89***************************...........
#=GC SS_cons ::::::::::::::::::::::::::::::::::::::::::::::::::
#=GC RF GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 00000000011111111112222222222333333333344444444445
#=GC RFCOL.X 12345678901234567890123456789012345678901234567890
How to interpret these alerts based on the above output: Several checks are made on the first position of all features, and these two sequences demonstrate failures due to some of these checks.
TOY50-IS1sequence:
The indf5gap alert with description INDEFINITE_ANNOTATION_START
is reported because there is a gap at the start position (5'
boundary) of the CDS named protein one. The first non-gap
nucleotide in the predicted CDS is position 10 of the sequence (seq coords:10..10:+). The 5' boundary gap is position 11 in the model
(mdl coords:11..11:+).
TOY50-IS2sequence:
The indf5lcc alert with description INDEFINITE_ANNOTATION_START
is reported because the posterior probability of the aligned nucleotide
at the start position (5' boundary) of the CDS named protein one is too low.
In this example the value is 0.8, and the minimum value to not report an
alert is 0.9 (alert detail:[0.80<0.90]). The minimum is actually
usually 0.8, but it was changed to 0.9 for demonstration purposes in this example
with the option --indefann 0.9. The nucleotide aligned at the 5' boundary is
sequence position 10 and it aligns to position 11 in the model.
Posterior probabilities are explained more here.
A similar indf5lcn alert exists for non-coding (non-CDS and
non-mature peptide) features, but no example is shown here. Having
separate alerts for coding and non-coding features gives the user
control over whether these types of alerts in coding versus non-coding
features cause a sequence to fail or not.
- Related
indf5pstandindf5plgalerts (not shown in example sequences above):
If the protein validation stage for a sequence results in too short of blastx
alignment of the predicted CDS to the reference protein that does not
extend close enough to the 5' boundary of the predicted CDS, the indf5pst
alert will be reported. This alert is not possible to generate with the toy50
toy model because the CDS in this example is too short for constructive use with blastx,
but a fabricated example .alt file output line is shown below,
in which the blastx alignment
extended only to sequence position 19, leaving positions 10 to 18 of the predicted CDS (seq coords:10..18:+), which align to
model positions 11 to 19 (mdl coords:11..19:+), uncovered by the blastx alignment. This length difference of 9
exceeds the maximum allowed difference of 5 (alert detail:[9>5]), so the alert is reported.
A similar indf5plg alert exists for when the blastx alignment extends longer than the
predicted nucleotide alignment on the 5' end, but no example is shown here.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ---- ----------- --- -------- ---- --------------------------- -------- --- -------- --- ------
4.2.1 TOY50.F1 toy50 CDS protein_one 1 indf5pst yes INDEFINITE_ANNOTATION_START 10..18:+ 9 11..19:+ 9 protein-based alignment does not extend close enough to nucleotide-based alignment 5' endpoint [9>5]
| relevant alert codes | corresponding alert descriptions |
|---|---|
| indf3gap, indf3lcc, indf3pst*, indf3lcn (not shown), indf3plg (not shown) | INDEFINITE_ANNOTATION_END |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-indefend.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-indefend/va-example-indefend.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ---- ----------- --- -------- ---- --------------------------- -------- --- -------- --- ------
1.1.4 TOY50-IE1 toy50 CDS protein_one 1 indf3gap yes INDEFINITE_ANNOTATION_END 28..28:+ 1 31..31:+ 1 alignment to homology model is a gap at 3' boundary [-]
#
2.1.1 TOY50-IE2 toy50 CDS protein_one 1 indf3lcc no INDEFINITE_ANNOTATION_END 30..30:+ 1 31..31:+ 1 alignment to homology model has low confidence at 3' boundary for feature that is or matches a CDS [0.70<0.80]
Alignment of TOY50-IE1 and TOY50-IE2 sequences to the toy50 model: The output
file va-example-indefend/va-example-indefend.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
v
TOY50-IE1 -AAATCACCGATGGTGATCGCTTTACCAT--ATGAGCAT-----------
#=GR TOY50-IE1 PP .**************************98..59******...........
TOY50-IE2 -AAATCACCGATGGTGATCCCTCTAGCATAGA-GAGCAT-----------
#=GR TOY50-IE2 PP .***************************9876.9*****...........
#=GC SS_cons ::::::::::::::::::::::::::::::::::::::::::::::::::
#=GC RF GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 00000000011111111112222222222333333333344444444445
#=GC RFCOL.X 12345678901234567890123456789012345678901234567890
How to interpret these alerts based on the above output: Several checks are made on the first position of all features, and these two sequences demonstrate failures to some of these checks.
TOY50-IE1sequence:
The indf3gap alert with description INDEFINITE_ANNOTATION_END
is reported because there is a gap at the end position (3'
boundary) of the CDS named protein one. The final
non-gap nucleotide in the predicted CDS is position 28 (seq coords:28..28:+) of the
sequence. The 3' boundary gap is position 31 in the model (mdl coords:31..31:+).
TOY50-IE2sequence:
The indf3lcc alert with description INDEFINITE_ANNOTATION_END
is reported because the posterior probability of the aligned nucleotide
at the end position (3' boundary) of the CDS named protein one is too low.
In this example the value is 0.7, and the minimum value to not report an
alert is 0.8 (alert detail:[0.70<0.80]). The nucleotide aligned at the 3' boundary is
sequence position 30 (seq coords:30..30:+) and it aligns to position 31 (mdl coords:31..31:+) in the model.
Posterior probabilities are explained more here.
A similar indf3lcn alert exists for non-coding (non-CDS and
non-mature peptide) features, but no example is shown here. Having
separate alerts for coding and non-coding features gives the user
control over whether these types of alerts in coding versus non-coding
features cause a sequence to fail or not.
- Related
indf3pstandindf3plgalerts (not shown in example sequences above):
If the protein validation stage for a sequence results in too short of blastx
alignment of the predicted CDS to the reference protein that does not
extend close enough to the 3' boundary of the predicted CDS, the indf3pst
alert will be reported. This alert is not possible to generate with the toy50
toy model because the CDS in this example is too short for constructive use with blastx.
But a fabricated example .alt file output line is shown below,
in which the blastx alignment
extended only to sequence position 21, leaving positions 22 to 30 of the predicted CDS (seq coords:22..30:+), which align to
model positions 23 to 31 (mdl coords:23..31:+), uncovered by the blastx alignment. This length difference of 9
exceeds the maximum allowed difference of 8 (alert detail:[9>8]), so the alert is reported.
A similar indf3plg alert exists for when the blastx alignment extends longer than the
predicted nucleotide alignment on the 3' end, but no example is shown here.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ---- ----------- --- -------- ---- --------------------------- -------- --- -------- --- ------
7.2.1 TOY50-F2 toy50 CDS protein_one 1 indf3pst yes INDEFINITE_ANNOTATION_END 22..30:+ 9 23..31:+ 9 protein-based alignment does not extend close enough to nucleotide-based alignment 3' endpoint [9>8]
| relevant alert codes | corresponding alert descriptions |
|---|---|
| ambgnt5s | AMBIGUITY_AT_START |
| ambgnt5c | AMBIGUITY_AT_CDS_START |
| ambgnt5f | AMBIGUITY_AT_FEATURE_START |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-ambigstart.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-ambigstart/va-example-ambigstart.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ----------- --------------- --- -------- ---- -------------------------- -------- --- -------- --- ------
1.1.1 TOY50-AS1 toy50 CDS protein_one 1 ambgnt5c no AMBIGUITY_AT_CDS_START 10..13:+ 4 11..14:+ 4 first nucleotide of CDS is an ambiguous nucleotide [-]
1.2.1 TOY50-AS1 toy50 mat_peptide protein_one_mp1 2 ambgnt5f no AMBIGUITY_AT_FEATURE_START 10..13:+ 4 11..14:+ 4 first nucleotide of non-CDS feature is an ambiguous nucleotide [-]
#
2.1.1 TOY50-AS2 toy50 - - - ambgnt5s no AMBIGUITY_AT_START 1..13:+ 13 2..14:+ 13 first nucleotide of the sequence is an ambiguous nucleotide [-]
2.2.1 TOY50-AS2 toy50 CDS protein_one 1 ambgnt5c no AMBIGUITY_AT_CDS_START 10..13:+ 4 11..14:+ 4 first nucleotide of CDS is an ambiguous nucleotide [-]
2.3.1 TOY50-AS2 toy50 mat_peptide protein_one_mp1 2 ambgnt5f no AMBIGUITY_AT_FEATURE_START 10..13:+ 4 11..14:+ 4 first nucleotide of non-CDS feature is an ambiguous nucleotide [-]
Alignment of TOY50-AS1 and TOY50-AS2 sequences to the toy50 model: The output
file va-example-ambigstart/va-example-ambigstart.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
vvvv
TOY50-AS1 -AAATCACCGNNNNTGATCGCTTTACCATAAATGAGCAT-----------
#=GR TOY50-AS1 PP .**************************************...........
TOY50-AS2 -NNNNNNNNNNNNNTGATCGCTTTACCATAAATGAGCAT-----------
#=GR TOY50-AS2 PP .**************************************...........
#=GC SS_cons ::::::::::::::::::::::::::::::::::::::::::::::::::
#=GC RF GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 00000000011111111112222222222333333333344444444445
#=GC RFCOL.X 12345678901234567890123456789012345678901234567890
How to interpret these alerts based on the above output: If the first position of each sequence or predicted feature is an N, an alert is reported.
TOY50-AS1sequence:
The ambgnt5c alert with description AMBIGUITY_AT_CDS_START
is reported because the predicted CDS named protein one begins
with 4 consecutive Ns from sequence positions 10
to 13 (seq coords:10..13:+) that align to the model (reference) positions 11 to 14 (mdl coords:11..14:+). These positions
are marked with vvvv in the alignment above. This alert is specific
to CDS features.
Similarly, the ambgnt5f alert with description AMBIGUITY_AT_FEATURE_START
is reported because the predicted mat_peptide named protein one mp1 begins
with 4 consecutive Ns from sequence positions 10
to 13 (seq coords:10..13:+) that align to the model (reference) positions 11 to 14 (mdl coords:11..14:+). These positions
are marked with vvvv in the alignment above. This alert is only reported
for non-CDS features.
TOY50-AS2sequence:
This sequence is similar to TOY50-AS1 except the stretch of Ns begins at
position 1 and extends to position 13 (seq coords:1..13:+). Because the first 4 nucleotides of
the CDS and mat_peptide are Ns like in TOY50-AS1, the same ambgnt5c and
ambgnt5f alerts are reported, but now with an additional ambgnt5s alert
with description AMBIGUITY_AT_START because the beginning of the sequence begins
with a consecutive string of 13 Ns.
This sequence is similar to TOY50-AS1 except the stretch of Ns
begins at position 1 and extends to position 13
position of the sequence causing the ambgnt5s
alert with description AMBIGUITY_AT_START to be reported because the sequence ends
with a stretch of 13 consecutive Ns. Because the first 4 nucleotides of
the CDS and mat_peptide are Ns like in TOY50-AS1, the same ambgnt5c and
ambgnt5f alerts are reported as well.
| relevant alert codes | corresponding alert descriptions |
|---|---|
| ambgnt3s | AMBIGUITY_AT_END |
| ambgnt3c | AMBIGUITY_AT_CDS_END |
| ambgnt3f | AMBIGUITY_AT_FEATURE_END |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-ambigend.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-ambigend/va-example-ambigend.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ---- ----------- --- -------- ---- -------------------- -------- --- -------- --- ------
1.1.1 TOY50-AE1 toy50 CDS protein_one 1 ambgnt3c no AMBIGUITY_AT_CDS_END 29..30:+ 2 30..31:+ 2 final nucleotide of CDS is an ambiguous nucleotide [-]
#
2.1.1 TOY50-AE2 toy50 - - - ambgnt3s no AMBIGUITY_AT_END 29..38:+ 10 30..39:+ 10 final nucleotide of the sequence is an ambiguous nucleotide [-]
2.2.1 TOY50-AE2 toy50 CDS protein_one 1 ambgnt3c no AMBIGUITY_AT_CDS_END 29..30:+ 2 30..31:+ 2 final nucleotide of CDS is an ambiguous nucleotide [-]
Alignment of TOY50-AE1 and TOY50-AE2 sequences to the toy50 model: The output
file va-example-ambigend/va-example-ambigend.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
vv
TOY50-AE1 -AAATCACCGATGGTGATCGCTTTACCATNNATGAGCAT-----------
#=GR TOY50-AE1 PP .**************************************...........
TOY50-AE2 -AAATCACCGATGGTGATCGCTTTACCATNNNNNNNNNN-----------
#=GR TOY50-AE2 PP .**************************************...........
#=GC SS_cons ::::::::::::::::::::::::::::::::::::::::::::::::::
#=GC RF GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 00000000011111111112222222222333333333344444444445
#=GC RFCOL.X 12345678901234567890123456789012345678901234567890
How to interpret these alerts based on the above output: If the first position of each sequence or predicted feature is an N, an alert is reported.
TOY50-AE1sequence:
The ambgnt3c alert with description AMBIGUITY_AT_CDS_END
is reported because the predicted CDS named protein one ends
with 2 consecutive Ns from sequence positions 29
to 30 (seq coords:29..30:+) that align to the model (reference) positions 30 to 31 (mdl coords:30..31:+). These positions
are marked with vv in the alignment above. This alert is specific
to CDS features.
A similar ambgnt3f alert exists for non-coding (non-CDS and non-mature peptide) features, but no example is shown here. Having separate alerts for coding and non-coding features gives the user control over whether these types of alerts in coding versus non-coding features cause a sequence to fail or not.
TOY50-AE2sequence:
This sequence is similar to TOY50-AE1 except the stretch of Ns
begins at position 29 and continues to the position 38 (seq coords:29..38:+) which is the final
position of the sequence causing the ambgnt3s
alert with description AMBIGUITY_AT_END to be reported because the sequence ends
with a stretch of 10 consecutive Ns. Because the
final 2 nucleotides of the CDS are Ns like in TOY50-AS1, the same
ambgnt3c alert is reported.
| relevant alert codes | corresponding alert descriptions |
|---|---|
| ambgcd5c | AMBIGUITY_IN_START_CODON |
| ambgcd3c | AMBIGUITY_IN_STOP_CODON |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-ambigcodon.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-ambigend/va-example-ambigend.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ---- ----------- --- -------- ---- -------------------- -------- --- -------- --- ------
1.1.1 TOY50-AC1 toy50 CDS protein_one 1 ambgcd5c no AMBIGUITY_IN_START_CODON 10..12:+ 3 11..13:+ 3 5' complete CDS starts with canonical nt but includes ambiguous nt in its start codon [ANG]
#
2.1.1 TOY50-AC2 toy50 CDS protein_one 1 ambgcd3c no AMBIGUITY_IN_STOP_CODON 28..30:+ 3 29..31:+ 3 3' complete CDS ends with canonical nt but includes ambiguous nt in its stop codon [TNA]
Alignment of TOY50-AC1 and TOY50-AC2 sequences to the toy50 model: The output
file va-example-ambigcodon/va-example-ambigcodon.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
vvv
TOY50-AC1 -AAATCACCGANGNTGATCGCTTTACCATAAATGAGCAT-----------
#=GR TOY50-AC1 PP .**************************************...........
TOY50-AC2 -AAATCACCGATGGTGATCGCTTTACCATNAATGAGCAT-----------
#=GR TOY50-AC2 PP .**************************************...........
#=GC RF GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 00000000011111111112222222222333333333344444444445
#=GC RFCOL.X 12345678901234567890123456789012345678901234567890
^^^
How to interpret these alerts based on the above output: If the first position of each sequence or predicted feature is an N, an alert is reported.
TOY50-AC1sequence:
The ambgcd5c alert with description AMBIGUITY_IN_START_CODON
is reported because the predicted CDS named protein one begins
with a start codon ANG that includes an ambiguous nucleotide but
starts with a canonical nt at sequence positions 10 to 12 (seq coords:10..12:+)
that align to the model (reference) positions 11 to 13 (mdl coords:11..13:+). These positions
are marked with vv in the alignment above. This alert is specific
to CDS features that are not truncated at the 5' end.
TOY50-AC2sequence:
The ambgcd3c alert with description AMBIGUITY_IN_STOP_CODON
is reported because the predicted CDS named protein one ends
with a stop codon TNA that includes an ambiguous nucleotide but
ends with a canonical nt at sequence positions 28 to 30 (seq coords:28..30:+)
that align to the model (reference) positions 29 to 31 (mdl coords:29..31:+). These positions
are marked with ^^ in the alignment above. This alert is specific
to CDS features that are not truncated at the 3' end.
| relevant alert codes | corresponding alert descriptions |
|---|---|
| pepadjcy | PEPTIDE_ADJACENCY_PROBLEM |
| peptrans | PEPTIDE_TRANSLATION_PROBLEM |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-matpep.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-matpep/va-example-matpep.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ----------- --------------- --- -------- ---- --------------------------- -------- --- -------- --- ------
1.1.1 TOY50-MP1 toy50 mat_peptide protein_one_mp1 2 pepadjcy yes PEPTIDE_ADJACENCY_PROBLEM 22..24:+ 3 22..23:+ 2 predictions of two mat_peptides expected to be adjacent are not adjacent [-]
#
2.1.1 TOY50-MP2 toy50 CDS protein_one 1 mutstart yes MUTATION_AT_START 10..12:+ 3 11..13:+ 3 expected start codon could not be identified [GTG]
2.2.1 TOY50-MP2 toy50 mat_peptide protein_one_mp1 2 peptrans yes PEPTIDE_TRANSLATION_PROBLEM - - - - mat_peptide may not be translated because its parent CDS has a problem [-]
2.3.1 TOY50-MP2 toy50 mat_peptide protein_one_mp2 3 peptrans yes PEPTIDE_TRANSLATION_PROBLEM - - - - mat_peptide may not be translated because its parent CDS has a problem [-]
Alignment of TOY50-MP1 and TOY50-MP2 sequences to the toy50 model: The output
file va-example-matpep/va-example-matpep.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
v v
TOY50-MP1 -AAATCACCGATGGTGATCGCTgggTTACCATAAATGAGCAT-----------
#=GR TOY50-MP1 PP .******************99766589***************...........
TOY50-MP2 -AAATCACCGGTGGTGATCGCT...TTACCATAAATGAGCAT-----------
#=GR TOY50-MP2 PP .*********************...*****************...........
#=GC SS_cons ::::::::::::::::::::::...::::::::::::::::::::::::::::
#=GC RF GAAATCACCGATGGTGATCGCT...TTACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 0000000001111111111222...2222222333333333344444444445
#=GC RFCOL.X 1234567890123456789012...3456789012345678901234567890
^^^
How to interpret these alerts based on the above output:
TOY50-MP1sequence:
When the protein product of a CDS is cleaved into multiple mature
peptides the mature peptide features typically are adjacent to each
other like they are for the toy example toy50 (details
here) in which protein one mp1 which spans nucleotide
positions 11 to 22, is adjacent to protein one mp2 which spans
positions 23 to 38. For these situations, v-annotate.pl checks that the predicted
mature peptide features in each sequence are adjacent, and if
not the pepadjcy alert is reported.
The pepadjcy alert with description PEPTIDE_ADJACENCY_PROBLEM is
reported for the TOY50-MP1 sequence because the predicted CDS
named protein one mp1 ends at position 21 and protein one mp2
begins at position 25, so the positions 22 to 24 lie between the two
mature peptide predictions (seq coords:22..24:+).
The model position that ends
protein one mp1 is 22, and that begins protein one mp2 is 23 (mdl coords:22..23:+).
TOY50-MP2sequence:
When a parent CDS of a mature peptide has a fatal alert, a
peptrans alert with description PEPTIDE_TRANSLATION_PROBLEM is
reported for all of the predicted child mature peptides. The
TOY50-MP2 sequence shows an example, which has a mutstart alert
for the CDS protein one which causes peptrans alerts for
the two mature peptides.
| relevant alert codes | corresponding alert descriptions |
|---|---|
| lowsim5c, lowsim5n (not shown), lowsim5l (not shown) | LOW_FEATURE_SIMILARITY_START |
| lowsim5s | LOW_SIMILARITY_START |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-lowsimstart.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-lowsimstart/va-example-lowsimstart.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- ---------- ----- ---- ----------- --- -------- ---- ---------------------------- ------- --- -------- --- ------
1.2.3 TOY50-LSS1 toy50 CDS protein_one 1 lowsim5c no LOW_FEATURE_SIMILARITY_START 1..13:+ 13 5..13:+ 9 region overlapping annotated feature that is or matches a CDS at 5' end of sequence lacks significant similarity [7 nt overlap b/t low similarity region of length 13 (1..13) and annotated feature (7..31)]
#
2.1.2 TOY50-LSS2 toy50 - - - lowsim5s yes LOW_SIMILARITY_START 1..10:+ 10 3..10:+ 8 significant similarity not detected at 5' end of the sequence [low similarity region of length 10]
Alignment of TOY50-LSS1 and TOY50-LSS2 sequences to the toy50 model: The output
file va-example-lowsimstart/va-example-lowsimstart.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
vvvvvv vvvvvvv
TOY50-LSS1 ----TTGTAG..GTTcgacGTGATCGCTTTACCATAAATGAGCAT-----------
#=GR TOY50-LSS1 PP ....998766..542223389************************...........
TOY50-LSS2 --GTTTAGTGgcATG....GTGATCGCTTTACCATAAATGAGCAT-----------
#=GR TOY50-LSS2 PP ..**9998775589*....**************************...........
#=GC SS_cons ::::::::::..:::....:::::::::::::::::::::::::::::::::::::
#=GC RF GAAATCACCG..ATG....GTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 0000000001..111....1111112222222222333333333344444444445
#=GC RFCOL.X 1234567890..123....4567890123456789012345678901234567890
Explanation of lowsim5c alert: The 13 nucleotides from
positions 1 to 13 in the sequence TOY50-LSS1 (seq coords:1..13:+) are at the 5' end
of the sequence and overlap by 7 nucleotides with the predicted CDS protein one but are not similar to the reference
model. These 13 nucleotides align to reference model positions 5 to 13 (mdl coords:5..13:+) and
include an insertion of 4 nucleotides after reference position 13. The 13 nucleotides
are marked by v characters in the alignment above.
Two similar alerts, lowsim5f and lowsim5l, exist for non-coding (non-CDS and
non-mature peptide) features, but no examples are shown here. lowsim5f is for relatively short regions
of low similarity, while lowsim5l is for longer regions (30nt or more). Having
separate alerts for coding and non-coding features gives the user
control over whether these types of alerts in coding versus non-coding features.
Explanation of lowsim5s alert: The first ten nucleotides
in the sequence TOY50-LSS2 are not similar to the reference model (seq coords:1..10:+)
and do not overlap with any predicted features. These ten nucleotides align to reference model positions 3 to 10,
(mdl coords:3..10:+) and include two inserted nucleotides after reference position 10.
Regions of low similarity are detected in the coverage
determination stage, as regions that are not covered by local
alignment hits between the sequence and the model, not based on
the global alignment determined in the alignment stage. In the
alignment above, note that the nucleotides in the low similarity
regions at the beginning of each sequence do not match well to the
nucleotides in the reference model (#=GC RF line).
| relevant alert codes | corresponding alert descriptions |
|---|---|
| lowsim3c, lowsim3n (not shown), lowsim3l (not shown) | LOW_FEATURE_SIMILARITY_END |
| lowsim3s | LOW_SIMILARITY_END |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-lowsimend.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-lowsimend/va-example-lowsimend.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- ---------- ----- ----------- --------------- --- -------- ---- ---------------------------- ------- --- -------- --- ------
1.2.2 TOY50-LSE1 toy50 CDS protein_one 1 lowsim3c no LOW_FEATURE_SIMILARITY_END 26..37:+ 12 26..31:+ 6 region overlapping annotated feature that is or matches a CDS at 3' end of sequence lacks significant similarity [12 nt overlap b/t low similarity region of length 12 (26..37) and annotated feature (10..37)]
#
2.1.2 TOY50-LSE2 toy50 - - - lowsim3s yes LOW_SIMILARITY_END 40..53:+ 14 35..46:+ 12 significant similarity not detected at 3' end of the sequence [low similarity region of length 14]
Alignment of TOY50-LSE1 and TOY50-LSE2 sequences to the toy50 model: The output
file va-example-lowsimend/va-example-lowsimend.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
vvvvvvvvvvvvv
TOY50-LSE1 -AAATCACCGATGGTGATCGCTTTACgtcccgtCTTAA----........---------------
#=GR TOY50-LSE1 PP .***********************975544444689**...........................
TOY50-LSE2 -AAATCACCGATGGTGATCGCTTTAC.......CATAAATGAcgatacacGAACTGCACGA----
#=GR TOY50-LSE2 PP .*************************.......********922222222334466799**....
#=GC SS_cons ::::::::::::::::::::::::::.......:::::::::........:::::::::::::::
#=GC RF GAAATCACCGATGGTGATCGCTTTAC.......CATAAATGA........GCATTCTACGTGCAT
#=GC RFCOLX. 00000000011111111112222222.......222333333........333344444444445
#=GC RFCOL.X 12345678901234567890123456.......789012345........678901234567890
^^^^^^^^^^^^^^^^^^^^
Explanation of lowsim3c alert: The 12 nucleotides from
positions 26 to 37 (seq coords:26..37:+) in the sequence TOY50-LSE1 are the 3' end
of the sequence and overlap with the predicted CDS protein one but are not similar to the reference
model. These 12 nucleotides align to reference model positions 26 to 31
(mdl coords:26..31:+) including an insertion of length 7 after model position 26.
The 12 nucleotides
are marked by v characters in the alignment above.
Two similar alerts, lowsim3f and lowsim3l, exist for non-coding (non-CDS and
non-mature peptide) features, but no examples are shown here. lowsim3f is for relatively short regions
of low similarity, while lowsim3l is for longer regions (30nt or more). Having
separate alerts for coding and non-coding features gives the user
control over whether these types of alerts in coding versus non-coding features.
Explanation of lowsim3s alert: The final 14 nucleotides
from positions 40 to 53 (seq coords:40..53:+) in the sequence TOY50-LSE2 are not similar to the reference model
and do not overlap with any predicted features. These 14 nucleotides align to reference model positions 35 to 46 (mdl coords:35..46:+),
and include 8 inserted nucleotides after reference position 35.
The alignment above shows the region of low similarity marked by ^ characters.
Regions of low similarity are detected in the coverage determination stage, as regions that are not covered by local alignment hits between the sequence and the model, not based on the global alignment determined in the alignment stage.
| relevant alert codes | corresponding alert descriptions |
|---|---|
| lowsimic, lowsimin (not shown), lowsimil (not shown) | LOW_FEATURE_SIMILARITY |
| lowsimis | LOW_SIMILARITY |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-lowsimint.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-lowsimint/va-example-lowsimint.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- ---------- ----- ---- ----------- --- -------- ---- ---------------------- --------- --- -------- --- ------
1.2.3 TOY50-LSI1 toy50 CDS protein_one 1 lowsimic no LOW_FEATURE_SIMILARITY 32..107:+ 76 27..28:+ 2 region overlapping annotated feature that is or matches a CDS lacks significant similarity [76 nt overlap b/t low similarity region of length 76 (32..107) and annotated feature (10..114)]
Alignment of TOY50-LSI1 sequence to the toy50 model: The output
file va-example-lowsimint/va-example-lowsimint.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
vvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv vvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv
TOY50-LSI1 -AAATCACCGATGGTGATCGCTTTACCaaagcagtacaggcacatgacaaagcagtacaggca-catgacaaagcagtacaggcacatgacaaagcagtacaggcacatgacaTAAATGAGCATTCTACGTGCAT
#=GR TOY50-LSI1 PP .**********************9875222222222222222222222222222222222222.222222222222222222222222222222222222222222222222267899*****************
#=GC SS_cons :::::::::::::::::::::::::::....................................:.................................................::::::::::::::::::::::
#=GC RF GAAATCACCGATGGTGATCGCTTTACC....................................A.................................................TAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 000000000111111111122222222....................................2.................................................2333333333344444444445
#=GC RFCOL.X 123456789012345678901234567....................................8.................................................9012345678901234567890
//
Explanation of lowsimic alert: The 76 nucleotides from
positions 32 to 107 (seq coords:32..107:+) in the sequence TOY50-LSI1 occur in the middle
of the predicted CDS protein one but are not similar to the reference
model. These 76 nucleotides align to reference model positions 27 to 28 (mdl coords:27..28:+),
but are all actually inserted after those two reference positions as marked with
v characters in the alignment shown above.
A similar lowsimin alert exists for non-coding (non-CDS and
non-mature peptide) features, but no example is shown here. Having
separate alerts for coding and non-coding features gives the user
control over whether these types of alerts in coding versus non-coding
Two similar alerts, lowsimif and lowsimil, exist for non-coding (non-CDS and
non-mature peptide) features, but no examples are shown here. lowsimif is for relatively short regions
of low similarity, while lowsimil is for longer regions (30nt or more). Having
separate alerts for coding and non-coding features gives the user
control over whether these types of alerts in coding versus non-coding features.
Regions of low similarity are detected in the coverage determination
stage, as regions that are not covered by local alignment hits between the
sequence and the model, not based on the global alignment determined in the
alignment stage. That is why the region marked with v characters above
which corresponds to the region of low similarity does not include the
full insertions after reference positions 27 and 28. Enough similarity exists in
the beginning of the insertion after position 27 and at the end of the insertion
after position 28 for a local alignment hit to include those regions.
| relevant alert codes | corresponding alert descriptions |
|---|---|
| extrant5 | EXTRA_SEQUENCE_START |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-extrant5.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-extrant5/va-example-extrant5.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- -------- ----- ---- ---- --- -------- ---- -------------------- ------ --- ------ --- ------
1.1.1 TOY50-E5 toy50 - - - extrant5 no EXTRA_SEQUENCE_START 1..6:+ 6 0..0:+ 1 extra sequence detected 5' of expected sequence start [6 extra nucleotides]
Alignment of the TOY50-E5 sequence to the toy50 model: The output
file va-example-extrant5/va-example-extrant5.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
vvvvvv
TOY50-E5 ctacctGAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GR TOY50-E5 PP ********************************************************
#=GC SS_cons ......::::::::::::::::::::::::::::::::::::::::::::::::::
#=GC RF ......GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. ......00000000011111111112222222222333333333344444444445
#=GC RFCOL.X ......12345678901234567890123456789012345678901234567890
Explanation of extrant5 alert: The 6 nucleotides from
positions 1 to 6 in the sequence TOY50-E5 (seq coords:1..6:+) are at the 5' end
of the sequence and are aligned before the first model (nongap RF) position.
The 6 nucleotides are marked by v characters in the alignment above.
By default if 5 or more nucleotides are inserted before the first model position a
extrant5 alert is reported, but 5 is changeable to <n> with the --extrant5 <n> option to
v-annotate.pl.
| relevant alert codes | corresponding alert descriptions |
|---|---|
| extrant3 | EXTRA_SEQUENCE_END |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-extrant3.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-extrant3/va-example-extrant3.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- -------- ----- ---- ---- --- -------- ---- ------------------ -------- --- -------- --- ------
1.1.1 TOY50-E3 toy50 - - - extrant3 no EXTRA_SEQUENCE_END 51..59:+ 9 50..50:+ 1 extra sequence detected 3' of expected sequence end [9 extra nucleotides]
Alignment of the TOY50-E3 sequence to the toy50 model: The output
file va-example-extrant3/va-example-extrant3.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
vvvvvvvvv
TOY50-E3 GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCATcaaaaaaaa
#=GR TOY50-E3 PP *************************************************9*********
#=GC SS_cons ::::::::::::::::::::::::::::::::::::::::::::::::::.........
#=GC RF GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT.........
#=GC RFCOLX. 00000000011111111112222222222333333333344444444445.........
#=GC RFCOL.X 12345678901234567890123456789012345678901234567890.........
Explanation of extrant3 alert: The 9 nucleotides from
positions 51 to 59 in the sequence TOY50-E3 (seq coords:51..59:+) are at the 3' end
of the sequence and are aligned after the final model (nongap RF) position.
The 9 nucleotides are marked by v characters in the alignment above.
By default if 5 or more nucleotides are inserted after the final model position a
extrant3 alert is reported, but 5 is changeable to <n> with the --extrant3 <n> option to
v-annotate.pl.
| relevant alert codes | corresponding alert descriptions |
|---|---|
| deletins, deletina (not shown) | DELETION_OF_FEATURE |
| deletinf (not shown) | DELETION_OF_FEATURE_SECTION |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-delftr.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-delftr/va-example-delftr.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ---- ---- --- -------- ---- ------------------- ------ --- -------- --- ------
1.1.1 TOY50-DF1 toy50 - - - deletins yes DELETION_OF_FEATURE - - 23..28:+ 6 internal deletion of a complete feature [mat_peptide feature number 2: protein one mp2]
Alignment of TOY50-DF1 sequence to the toy50 model: The output
file va-example-delftr/va-example-delftr.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
vvvvvv
TOY50-DF1 -AAATCACCGATGGTGATCGC--------AAATGAGCATTCTACGTGCAT
#=GR TOY50-DF1 PP .*****************997........79*******************
#=GC SS_cons ::::::::::::::::::::::::::::::::::::::::::::::::::
#=GC RF GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 00000000011111111112222222222333333333344444444445
#=GC RFCOL.X 12345678901234567890123456789012345678901234567890
Explanation of deletins alert: The mature peptide feature named protein one mp2
is deleted in the sequence TOY50-DF1, as indicated in the alert detail field of the
.alt file above. That mature peptide spans model positions 23 to 28 (model coords:23..28:+) which can be
seen as gaps in the above alignment, and are marked with positions v.
A similar deletina alert will be reported if the feature that is deleted
has the is_deletable field set to 1 in the input .minfo file.
No example of this alert is shown here.
A similar deletinf alert exists for multi-segment features for which
one or more but not all segments are deleted. The associated value for this
alert in the alert desc field is DELETION_OF_FEATURE_SECTION.
No example of this alert is shown here.
| relevant alert codes | corresponding alert descriptions |
|---|---|
| dupregin | DUPLICATE_REGION |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-dupregin.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-dupregin/va-example-dupregin.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ---- ---- --- -------- ---- ----------------- ---------------- --- --------------- --- ------
1.1.1 TOY50-DR1 toy50 - - - dupregin yes DUPLICATE_REGIONS 1..49:+,50..86:+ 86 2..50:+,7..43:+ 86 similarity to a model region occurs more than once [7..43 (len 37>=20) hits 1 (39.5 bits) and 2 (27.0 bits)]
Alignment of TOY50-DR1 sequence to the toy50 model: The output
file va-example-dupregin/va-example-dupregin.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
|positions 50 to 86 in the sequence-|
vvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv
TOY50-DR1 -AAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCataccgatggtgatcgctttaccataaatgagcattctA-
#=GR TOY50-DR1 PP .********************************************987444444444444444444444444444444444444446.
#=GC SS_cons ::::::::::::::::::::::::::::::::::::::::::::::::......................................::
#=GC RF GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGC......................................AT
#=GC RFCOLX. 000000000111111111122222222223333333333444444444......................................45
#=GC RFCOL.X 123456789012345678901234567890123456789012345678......................................90
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
|--positions 7 to 43 in the model---|
Explanation of dupregin alert: There are two hits in the
coverage determination stage, which overlap in model coordinates by
more than 20 positions which cause the dupregin alert to be reported.
Specifically, hit 1 is from
positions 1 to 49 in the sequence (seq coords:1..49:+) and 2 to 50 in the model (mdl coords:2..50:+) and hit 2
is from positions 50 to 86 in the sequence (seq coords:50..86:+) and positions 7 to 43 in
the model (mdl coords;7..43)). The hits overlap by
37 model positions from 7 to 43, which is above the minimum length
threshold for reporting this alert of 20 (alert detail: 7..43 (len 37 >= 20)). The first hit has a bit score of 39.5 bits and the
second hit of 27.0 bits (alert detail: hits 1 (39.5 bits) and 2 (27.0 bits)).
In the alignment of the sequence above sequence positions 50 to 86
are marked marked by v characters at the top of the alignment,
which match identically to positions 7 to 43 in the reference model,
marked by ^ at the bottom of the alignment.
| relevant alert codes | corresponding alert descriptions |
|---|---|
| discontn | *DISCONTINUOUS_SIMILARITY |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-discontn.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-discontn/va-example-discontn.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ---- ---- --- -------- ---- ------------------------ ---------------- --- ---------------- --- ------
1.1.1 TOY50-DS1 toy50 - - - discontn yes DISCONTINUOUS_SIMILARITY 1..26:+,27..49:+ 49 25..50:+,2..24:+ 49 not all hits are in the same order in the sequence and the homology model [seq order: 1,2, mdl order: 2,1]
Alignment of TOY50-DS1 sequence to the toy50 model: The output
file va-example-discontn/va-example-discontn.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
|-27 to 49 in the seq-|
vvvvvvvvvvvvvvvvvvvvvvv
TOY50-DS1 ------------------------ACCATAAATGAGCATTCTACGTGCAtaaatcaccgatggtgatcgcttT
#=GR TOY50-DS1 PP ........................**********************98666666667777777777777777*
#=GC SS_cons :::::::::::::::::::::::::::::::::::::::::::::::::.......................:
#=GC RF GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCA.......................T
#=GC RFCOLX. 0000000001111111111222222222233333333334444444444.......................5
#=GC RFCOL.X 1234567890123456789012345678901234567890123456789.......................0
^^^^^^^^^^^^^^^^^^^^^^^
|--2-24 in the model--|
Explanation of discontn alert: For the TOY50-DS1 sequence,
there are two hits in the coverage determination stage and they are
not in the same order in sequence and model coordinates. The
positional information for these hits are reported in the seq coords, mdl coords and alert detail fields of the .alt file
above. Specifically, hit 1 is from positions 1 to 26 in the
sequence (seq coords:1..26:+) and 25 to 50 in the model (mdl coords:25..50:+) and hit 2 is from positions 27 to
49 in the sequence (seq coords:27..49:+) and positions 2 to 24 in the model (mdl coords:2..24:+).
So hit 1 comes before hit 2 in the
sequence, but hit 2 comes before hit 1 in the model. The order of
the hits in the sequence and model is reported in the alert detail
field: seq order: 1,2, mdl order: 2,1.
In the alignment of the sequence above, sequence positions 27 to 49
are marked marked by v characters at the top of the alignment.
These sequence positions match identically to positions 2 to 24 in
the reference model, marked by ^ at the bottom of the alignment,
showing why the second hit is to the end of the sequence and the
beginning of the model. The first hit pertains to the the beginning
of the sequence which matches well to the end of the model (the
region with * values in the PP line).
| relevant alert codes | corresponding alert descriptions |
|---|---|
| indfstrn, indfstrp (not shown) | INDEFINITE_STRAND |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-indfstrn.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-indfstrn/va-example-indfstrn.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ---- ---- --- -------- ---- ----------------- -------- --- -------- --- ------
1.1.2 TOY50-IS1 toy50 - - - indfstrn yes INDEFINITE_STRAND 49..25:- 25 26..50:+ 25 significant similarity detected on both strands [score:12.7>12.0]
Alignment of TOY50-IS1 sequence to the toy50 model: The output
file va-example-indfstrn/va-example-indfstrn.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
| 25 to 49 in the seq |
vvvvvvvvvvvvvvvvvvvvvvvvv
TOY50-IS1 -AAATCACCGATGGTGATCGCTTTAATGCAcgtagAATGCTCATTTATGG-----
#=GR TOY50-IS1 PP .**********************98544332222389999**********.....
#=GC SS_cons ::::::::::::::::::::::::::::::.....::::::::::::::::::::
#=GC RF GAAATCACCGATGGTGATCGCTTTACCATA.....AATGAGCATTCTACGTGCAT
#=GC RFCOLX. 000000000111111111122222222223.....33333333344444444445
#=GC RFCOL.X 123456789012345678901234567890.....12345678901234567890
^^^^^ ^^^^^^^^^^^^^^^^^^^^
| 26 to 50 in the model |
Explanation of indfstrn alert: For the TOY50-IS1 sequence
there are two hits in the coverage determination stage and they are
not to the same strand. The
positional information for these hits are reported in the seq coords, mdl coords and alert detail fields of the .alt file
above. Specifically, the top-scoring hit is to the + strand,
but the second hit with a score of 12.7 bits is on the - strand.
The second hit occurs from positions to 49 to 25 on the negative strand (seq coords:49..25:-) to
positions 26 to 50 in the reference model (mdl coords:26..50:+)
The second hit therefore
conflicts with the top-scoring hit and so it is the one that is
described in the seq coords and mdl coords fields. Normally, a
indfstrn alert is only reported if a hit on the opposite strand
from the top hit exceeds 25 bits, but to construct this example, the
minimum of 25 bits was lowered to 12 bits with the --indefstr 12
flag to v-annotate.pl.
In the alignment of the sequence above, sequence positions 25 to
49 are marked marked by v characters at the top of the alignment,
after reverse complementing these match identically to positions 26
to 50 in the reference model, marked by ^ at the bottom of the
alignment.
The indftrsn alert is detected in the coverage determination stage
which is based on the nucleotide sequence. A similar indfstrp
alert can be reported when blastx hits occur on both strands as
detected in the protein validation stage, but is not
shonw. Sometimes you will see both alerts for the same sequence.
| relevant alert codes | corresponding alert descriptions |
|---|---|
| lowcovrg | LOW_COVERAGE |
Instructions to reproduce this example and create the files discussed below:
> sh $VADRSCRIPTSDIR/documentation/alert-files/example-lowcovrg.sh
The above command will run v-annotate.pl and create many output files in a newly created directory. The output shown in the box below is from the .alt output file (va-example-lowcovrg/va-example-lowcovrg.vadr.alt) . Similar information with the seq and mdl coords fields can be found in the .alt.list output file and in the detailed error report .tsv file generated by the GenBank submission portal. You may have to scroll to the right to see the alert detail field.
# seq ftr ftr ftr alert alert seq seq mdl mdl alert
#idx name model type name idx code fail description coords len coords len detail
#---- --------- ----- ---- ---- --- -------- ---- ------------------------ ---------------- --- ---------------- --- ------
1.1.1 TOY50-LC1 toy50 - - - lowcovrg yes LOW_COVERAGE 1..25:+ 25 - - low sequence fraction with significant similarity to homology model [0.545<0.900]
Alignment of TOY50-LC1 sequence to the toy50 model: The output
file va-example-lowcovrg/va-example-lowcovrg.vadr.toy50.align.stk.
includes the alignment shown below. Looking at this alignment, or an
alignment of the sequence generated by a different program, can be
helpful in understanding the alerts.
The #=GC RF line shows the toy50 reference model sequence. The #=GR PP line
indicates confidence estimates for each aligned nucleotide as
explained more here. This alignment is only output when the
--keep or --out_stk options are used with v-annotate.pl.
|1 to 25 in the sequence|
vvvvvvvvvvvvvvvvvvvvvvvvv
TOY50-LC1 GAtacatcgatcatcaatccgggacaAATCACCGATGGTGATCGCTTTACCATAA-------------------
#=GR TOY50-LC1 PP *64444444444444333333333336899*************************...................
#=GC SS_cons ::........................::::::::::::::::::::::::::::::::::::::::::::::::
#=GC RF GA........................AATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC RFCOLX. 00........................000000011111111112222222222333333333344444444445
#=GC RFCOL.X 12........................345678901234567890123456789012345678901234567890
Explanation of lowcovrg alert: For the TOY50-LC1 sequence
the nucleotides from 1 to 25 are not part of any hit to the model in
the coverage determation stage (seq coords:1..25:+). These 25 nucleotides make up 45.5%
the total length of the sequence, meaning that only 54.5% of the
sequence is covered by hits to the model (alert detail:[0.545<0.900]). The lowcovrg alert is reported
for any sequence if less than 90% of the sequence is covered by hits to the model
(changeable to <x> with the --lowcov <x> option).
In the alignment of the sequence above, note that positions 1 to 25, marked
by v characters at the top of the alignment, do not match well to the model.
The TOY50 model is a toy example used to illustrate many of the
problems with sequences that VADR can detect using simple examples on
this page. The TOY50 model is 50 nucleotides long and includes 1 CDS
feature from positions 11 to 31 with the name (product) of protein one . That CDS is composed of two adjacent mature peptides: protein one mp1 from positions 11 to 22 and protein one mp2 from positions
23 to 28. The final 3 nucleotides of the CDS, 29 to 31, are the stop
codon. The model info file for the TOY50 model is shown below.
MODEL TOY50 cmfile:"toy50.cm" group:"toy" length:"50" subgroup:"A" blastdb:"toy50.protein.fa"
FEATURE TOY50 type:"CDS" coords:"11..31:+" parent_idx_str:"GBNULL" gene:"one" product:"protein one"
FEATURE TOY50 type:"mat_peptide" coords:"11..22:+" parent_idx_str:"0" product:"protein one mp1"
FEATURE TOY50 type:"mat_peptide" coords:"23..28:+" parent_idx_str:"0" product:"protein one mp2"
The reference sequence for the TOY50 model is shown below, as a
Stockholm format alignment file (even though it has one sequence)
with special markup in the form of #=GC columns to show where the
CDS and mature peptide features are, as well as the sequence position
information:
# STOCKHOLM 1.0
TOY50 GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCTACGTGCAT
#=GC CDS1.11..31:+ ..........123123123123123123stp...................
#=GC MP1.11..22:+ ..........123123123123............................
#=GC MP2.23..28:+ ......................123123......................
#=GC RFCOLX. 00000000011111111112222222222333333333344444444445
#=GC RFCOL.X 12345678901234567890123456789012345678901234567890
//
Stockholm format is described in more detail at https://en.wikipedia.org/wiki/Stockholm_format and http://eddylab.org/infernal/Userguide.pdf (section 9: "File and output formats")
The v-annotate.pl script uses a probabilistic model called a
covariance model (CM) to calculate glocal alignments of input
sequences in the alignment stage (unless the --glsearch option is
used, in which case a non-probabilistic alignment algorithm is used).
As part of the CM alignment calculation, the posterior probability
(PP) that each aligned nucleotide appears at its assigned alignment
position is calculated. These posterior probabilities are confidence
estimates that each nucleotide is correctly aligned given the
parameters of the CM. The Stockholm alignments output from
v-annotate.pl include annotation on the alignment that indicates
these PP values. An example is below:
# STOCKHOLM 1.0
#=GF AU Infernal 1.1.4
toy50-1 GGTATCACAGATGGGATCCGCTGACTCAT-AATGTGTGTTCAaAAGTGCAT
#=GR toy50-1 PP 999*********99888888877766766.567888887775257999999
#=GC RF GAAATCACCGATGGTGATCGCTTTACCATAAATGAGCATTCT.ACGTGCAT
#=GC RFCOLX. 000000000111111111122222222223333333333444.44444445
#=GC RFCOL.X 123456789012345678901234567890123456789012.34567890
The top line beginning with toy50-1 shows the alignment of the sequence named
toy50-1. - characters here indicate deletions with respect to the model (gaps).
The #=GC RF line shows the reference model sequence. . characters in this line indicate
positions that are insertions relative to the model in one or more of the aligned sequences.
The #=GC RFCOLX. line shows the tens value of the reference position of each column.
The #=GC RFCOL.X line shows the ones value of the reference position of each column.
(E.g. the final column is reference position 50.)
The posterior probability confidence estimates are shown in the #=GR toy50-1 PP line. Characters in PP rows have 12 possible values:
| PP character | meaning |
|---|---|
. |
this position is a gap in the sequence |
0 |
posterior probability between 0.00 and 0.05 |
1 |
posterior probability between 0.05 and 0.15 |
2 |
posterior probability between 0.15 and 0.25 |
3 |
posterior probability between 0.25 and 0.35 |
4 |
posterior probability between 0.35 and 0.45 |
5 |
posterior probability between 0.45 and 0.55 |
6 |
posterior probability between 0.55 and 0.65 |
7 |
posterior probability between 0.65 and 0.75 |
8 |
posterior probability between 0.75 and 0.85 |
9 |
posterior probability between 0.85 and 0.95 |
* |
posterior probability between 0.95 and 1.00 |
In the above alignment, the 9 positions 4 to 12 have * PP values, indicating that
those positions are very confidently aligned at the correct positions given the parameters of the model.
As you might expect, these positions nearly exactly match the model nucleotides they are aligned to.
Positions surrounding insertions and deletions tend to have lower PP
values because there is more uncertainty as to where each specific
nucleotide should be placed in the alignment. For example, reference
position 29 and 30 which are separated by an insertion in the sequence
have PP values of 6 and 5.
PP values are used by v-annotate.pl in two contexts:
- To distinguish between low-confidence and high-confidence frameshift regions (fsthicf* vs fstlocf* alerts, see this example).
- To report alerts when feature boundaries have low confidence (indf5lc* and indf3lc* alerts, see example at 5' end and 3' end.