Skip to content

Commit

Permalink
Update for version 0.15
Browse files Browse the repository at this point in the history
  • Loading branch information
iwc-workflows-bot committed May 30, 2024
1 parent b2f4734 commit 32277c8
Show file tree
Hide file tree
Showing 3 changed files with 39 additions and 29 deletions.
10 changes: 10 additions & 0 deletions CHANGELOG.md
Original file line number Diff line number Diff line change
@@ -1,5 +1,15 @@
# Changelog

## [0.15] 2024-05-27

### Automatic update
- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy1`
- `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1`
- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0`
- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_slopbed/2.30.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_slopbed/2.31.1+galaxy0`
- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.30.0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1`
- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.31.1+galaxy0`

## [0.14] 2024-04-22

### Automatic update
Expand Down
52 changes: 26 additions & 26 deletions atacseq.ga
Original file line number Diff line number Diff line change
Expand Up @@ -10,7 +10,7 @@
],
"format-version": "0.1",
"license": "MIT",
"release": "0.14",
"release": "0.15",
"name": "ATACseq",
"steps": {
"0": {
Expand Down Expand Up @@ -123,7 +123,7 @@
},
"4": {
"annotation": "",
"content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy0",
"content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy1",
"errors": null,
"id": 4,
"input_connections": {
Expand Down Expand Up @@ -173,23 +173,23 @@
"output_name": "report"
}
},
"tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy0",
"tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy1",
"tool_shed_repository": {
"changeset_revision": "b1c926deaa2d",
"changeset_revision": "fe74900d6dc7",
"name": "cutadapt",
"owner": "lparsons",
"tool_shed": "toolshed.g2.bx.psu.edu"
},
"tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"maximum_length\": null, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Nextera R1\", \"adapter\": \"CTGTCTCTTATACACATCTCCGAGCCCACGAGAC\"}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": []}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Nextera R2\", \"adapter\": \"CTGTCTCTTATACACATCTGACGCTGCCGACGA\"}, \"single_noindels\": false}], \"front_adapters2\": [], \"anywhere_adapters2\": [], \"cut2\": \"0\", \"quality_cutoff2\": \"\", \"minimum_length2\": null, \"maximum_length2\": null}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"cut\": \"0\", \"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
"tool_version": "4.8+galaxy0",
"tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Nextera R1\", \"adapter\": \"CTGTCTCTTATACACATCTCCGAGCCCACGAGAC\"}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": []}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Nextera R2\", \"adapter\": \"CTGTCTCTTATACACATCTGACGCTGCCGACGA\"}, \"single_noindels\": false}], \"front_adapters2\": [], \"anywhere_adapters2\": []}, \"pair_adapters\": false}, \"other_trimming_options\": {\"cut\": \"0\", \"cut2\": \"0\", \"quality_cutoff\": \"30\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"strip_suffix\": \"\", \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
"tool_version": "4.8+galaxy1",
"type": "tool",
"uuid": "33fa2759-9f3f-431b-b35c-b5c777d5d5b7",
"when": null,
"workflow_outputs": []
},
"5": {
"annotation": "",
"content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy0",
"content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1",
"errors": null,
"id": 5,
"input_connections": {
Expand Down Expand Up @@ -249,15 +249,15 @@
"output_name": "output"
}
},
"tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy0",
"tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1",
"tool_shed_repository": {
"changeset_revision": "0d4acadabb04",
"changeset_revision": "d5ceb9f3c25b",
"name": "bowtie2",
"owner": "devteam",
"tool_shed": "toolshed.g2.bx.psu.edu"
},
"tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"--very-sensitive\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false, \"paired_options\": {\"paired_options_selector\": \"no\", \"__current_case__\": 1}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
"tool_version": "2.5.3+galaxy0",
"tool_version": "2.5.3+galaxy1",
"type": "tool",
"uuid": "c32a3847-f673-487f-af98-8d50999f2d21",
"when": null,
Expand Down Expand Up @@ -491,7 +491,7 @@
},
"10": {
"annotation": "",
"content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2",
"content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0",
"errors": null,
"id": 10,
"input_connections": {
Expand Down Expand Up @@ -527,15 +527,15 @@
"output_name": "output"
}
},
"tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2",
"tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0",
"tool_shed_repository": {
"changeset_revision": "a1a923cd89e8",
"changeset_revision": "64e2edfe7a2c",
"name": "bedtools",
"owner": "iuc",
"tool_shed": "toolshed.g2.bx.psu.edu"
},
"tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"ed_score\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"split\": false, \"tag\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
"tool_version": "2.30.0+galaxy2",
"tool_version": "2.31.1+galaxy0",
"type": "tool",
"uuid": "12ca18f2-222b-4e9c-8ae0-b5772cd51bd7",
"when": null,
Expand Down Expand Up @@ -881,7 +881,7 @@
},
"16": {
"annotation": "",
"content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_slopbed/2.30.0+galaxy1",
"content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_slopbed/2.31.1+galaxy0",
"errors": null,
"id": 16,
"input_connections": {
Expand Down Expand Up @@ -926,15 +926,15 @@
"output_name": "output"
}
},
"tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_slopbed/2.30.0+galaxy1",
"tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_slopbed/2.31.1+galaxy0",
"tool_shed_repository": {
"changeset_revision": "a1a923cd89e8",
"changeset_revision": "64e2edfe7a2c",
"name": "bedtools",
"owner": "iuc",
"tool_shed": "toolshed.g2.bx.psu.edu"
},
"tool_state": "{\"addition\": {\"addition_select\": \"b\", \"__current_case__\": 0, \"b\": \"500\"}, \"genome_file_opts\": {\"genome_file_opts_selector\": \"loc\", \"__current_case__\": 0, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"header\": false, \"inputA\": {\"__class__\": \"ConnectedValue\"}, \"pct\": false, \"strand\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
"tool_version": "2.30.0+galaxy1",
"tool_version": "2.31.1+galaxy0",
"type": "tool",
"uuid": "d1c672ca-ee55-4e48-9d97-75552050534a",
"when": null,
Expand Down Expand Up @@ -1080,7 +1080,7 @@
},
"20": {
"annotation": "",
"content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.30.0",
"content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1",
"errors": null,
"id": 20,
"input_connections": {
Expand Down Expand Up @@ -1111,15 +1111,15 @@
"output_name": "output"
}
},
"tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.30.0",
"tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1",
"tool_shed_repository": {
"changeset_revision": "a1a923cd89e8",
"changeset_revision": "64e2edfe7a2c",
"name": "bedtools",
"owner": "iuc",
"tool_shed": "toolshed.g2.bx.psu.edu"
},
"tool_state": "{\"c_and_o_argument_repeat\": [], \"distance\": \"0\", \"header\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"strand\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
"tool_version": "2.30.0",
"tool_version": "2.31.1",
"type": "tool",
"uuid": "a74b6905-51b8-4c39-bc8c-3267b1f0a7a5",
"when": null,
Expand Down Expand Up @@ -1207,7 +1207,7 @@
},
"22": {
"annotation": "",
"content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0+galaxy1",
"content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.31.1+galaxy0",
"errors": null,
"id": 22,
"input_connections": {
Expand Down Expand Up @@ -1252,15 +1252,15 @@
"output_name": "output"
}
},
"tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0+galaxy1",
"tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.31.1+galaxy0",
"tool_shed_repository": {
"changeset_revision": "a1a923cd89e8",
"changeset_revision": "64e2edfe7a2c",
"name": "bedtools",
"owner": "iuc",
"tool_shed": "toolshed.g2.bx.psu.edu"
},
"tool_state": "{\"a_or_b\": false, \"d\": false, \"hist\": false, \"inputA\": {\"__class__\": \"ConnectedValue\"}, \"mean\": false, \"overlap_a\": null, \"overlap_b\": null, \"reciprocal_overlap\": false, \"reduce_or_iterate\": {\"reduce_or_iterate_selector\": \"iterate\", \"__current_case__\": 0, \"inputB\": {\"__class__\": \"ConnectedValue\"}}, \"sorted\": false, \"split\": false, \"strandedness\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
"tool_version": "2.30.0+galaxy1",
"tool_version": "2.31.1+galaxy0",
"type": "tool",
"uuid": "f3681ac7-e1ba-4442-971f-8353389c5265",
"when": null,
Expand Down
6 changes: 3 additions & 3 deletions ro-crate-metadata.json
Original file line number Diff line number Diff line change
Expand Up @@ -21,7 +21,7 @@
{
"@id": "./",
"@type": "Dataset",
"datePublished": "2024-04-29T08:49:48.242493",
"datePublished": "2024-05-30T07:39:05.349250",
"hasPart": [
{
"@id": "atacseq.ga"
Expand Down Expand Up @@ -72,7 +72,7 @@
"@id": "#galaxy"
},
"url": "https://github.com/iwc-workflows/atacseq",
"version": "0.14"
"version": "0.15"
},
{
"@id": "#galaxy",
Expand Down Expand Up @@ -138,7 +138,7 @@
"conformsTo": {
"@id": "https://w3id.org/ro/terms/test#PlanemoEngine"
},
"engineVersion": ">=0.75.22"
"engineVersion": ">=0.75.23"
},
{
"@id": "https://w3id.org/ro/terms/test#PlanemoEngine",
Expand Down

0 comments on commit 32277c8

Please sign in to comment.