diff --git a/workflows/transcriptomics/rnaseq-sr/.dockstore.yml b/workflows/transcriptomics/rnaseq-sr/.dockstore.yml index 61f298b5c..a41c35c2d 100644 --- a/workflows/transcriptomics/rnaseq-sr/.dockstore.yml +++ b/workflows/transcriptomics/rnaseq-sr/.dockstore.yml @@ -9,3 +9,5 @@ workflows: authors: - name: Lucille Delisle orcid: 0000-0002-1964-4960 + - name: Pavankumar Videm + orcid: 0000-0002-5192-126X \ No newline at end of file diff --git a/workflows/transcriptomics/rnaseq-sr/CHANGELOG.md b/workflows/transcriptomics/rnaseq-sr/CHANGELOG.md index 389e9e12d..a389faa24 100644 --- a/workflows/transcriptomics/rnaseq-sr/CHANGELOG.md +++ b/workflows/transcriptomics/rnaseq-sr/CHANGELOG.md @@ -1,5 +1,18 @@ # Changelog +## [1.0] 2024-10-22 + +### Changes in workflows +- Add an optional subworkflow with more QC: FastQC, Picard, Read distribution on genomic features, gene body coverage, reads per chromosomes. +- Add featureCounts as an alternative way to generate count files +- Use fastp instead of cutadapt which uses pair overlap and allows to have optional adapter sequences + +### Tool update +- `toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.3` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.4` + +### Test dataset +- Using a new subsampled Yeast test data from Zenodo record https://zenodo.org/records/13987631 + ## [0.9] 2024-09-23 ### Automatic update diff --git a/workflows/transcriptomics/rnaseq-sr/README.md b/workflows/transcriptomics/rnaseq-sr/README.md index 09236c628..7e3de2c65 100644 --- a/workflows/transcriptomics/rnaseq-sr/README.md +++ b/workflows/transcriptomics/rnaseq-sr/README.md @@ -2,9 +2,9 @@ ## Inputs dataset -- The workflow needs a list of datasets of fastqsanger. -- As well as a gtf file with genes -- Optional, but recommended: a gtf file with regions to exclude from normalization in Cufflinks. +- Collection of FASTQ files: The workflow needs a list of datasets of fastqsanger. +- GTF file of annotation: A gtf file with genes annotation. +- GTF with regions to exclude from FPKM normalization with Cufflinks: Optional, but recommended. A gtf file with regions to exclude from normalization in Cufflinks. - For instance a gtf that masks chrM for the mm10 genome: @@ -15,11 +15,13 @@ chrM chrM_gene exon 0 16299 . - . gene_id "chrM_gene_minus"; transcript_id "chrM ## Inputs values -- forward adapter sequence: this depends on the library preparation. Usually classical Illumina RNA libraries are Truseq and ISML (relatively new Illumina library) is Nextera. If you don't know, use FastQC to determine if it is Truseq or Nextera. If the read length is relatively short (50bp), there is probably no adapter so it will not impact your results. -- reference_genome: this field will be adapted to the genomes available for STAR -- strandedness: For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence. This will only count alignments that are compatible with your library preparation strategy. This is also used for the stranded coverage and for FPKM computation with cufflinks/StringTie. -- cufflinks_FPKM: Whether you want to get FPKM with Cufflinks (pretty long) -- stringtie_FPKM: Whether you want to get FPKM/TPM etc... with Stringtie. +- Forward adapter (optional): If not provided, fastp will try to guess the adapter sequence from the data. Its sequences depends on the library preparation. Usually classical Illumina RNA libraries are Truseq and ISML (relatively new Illumina library) is Nextera. If you don't know, use FastQC to determine if it is Truseq or Nextera. If the read length is relatively short (50bp), there is probably no adapter so it will not impact your results. +- Generate additional QC reports: whether to compute additional QC: FastQC, Picard, Read distribution on genomic features, gene body coverage, reads per chromosomes. +- Reference genome: this field will be adapted to the genomes available for STAR. +- Strandedness: For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence. This will only count alignments that are compatible with your library preparation strategy. This is also used for the stranded coverage and for FPKM computation with cufflinks/StringTie. +- Use featureCounts for generating count tables: Whether to use count tables from featureCounts instead of from STAR. +- Compute Cufflinks FPKM: Whether you want to get FPKM with Cufflinks (pretty long). +- Compute StringTie FPKM: Whether you want to get FPKM/TPM etc... with StringTie. ## Processing @@ -41,6 +43,12 @@ chrM chrM_gene exon 0 16299 . - . gene_id "chrM_gene_minus"; transcript_id "chrM ## Contribution +### Version 0.1 + @lldelisle wrote the workflow and the tests. @nagoue updated the tools, made it work in usegalaxy.org, fixed some best practices. + +### Version 1.0 + +@pavanvidem added the new features (featurecount + additional QC) and found a smaller test dataset. diff --git a/workflows/transcriptomics/rnaseq-sr/rnaseq-sr-tests.yml b/workflows/transcriptomics/rnaseq-sr/rnaseq-sr-tests.yml index 6be85c478..e202d36c7 100644 --- a/workflows/transcriptomics/rnaseq-sr/rnaseq-sr-tests.yml +++ b/workflows/transcriptomics/rnaseq-sr/rnaseq-sr-tests.yml @@ -1,101 +1,76 @@ - doc: Test outline for RNAseq_SR job: - gtf: + GTF file of annotation: class: File - location: https://zenodo.org/record/4541751/files/Drosophila_melanogaster.BDGP6.87.gtf + location: https://zenodo.org/records/13987631/files/Saccharomyces_cerevisiae.R64-1-1.113.gtf filetype: gtf - SR fastq input: + Collection of FASTQ files: class: Collection collection_type: list elements: - class: File - identifier: GSM461177 - location: https://zenodo.org/record/4541751/files/GSM461177_1_subsampled.fastqsanger - forward_adapter: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC - reference_genome: dm6 - strandedness: unstranded - cufflinks_FPKM: true - stringtie_FPKM: true + identifier: SRR5085167 + location: https://zenodo.org/records/13987631/files/SRR5085167_forward.fastqsanger.gz + Forward adapter: AGATCGGAAGAG + Generate additional QC reports: true + Reference genome: sacCer3 + Strandedness: stranded - forward + Use featureCounts for generating count tables: true + Compute Cufflinks FPKM: true + GTF with regions to exclude from FPKM normalization with Cufflinks: null + Compute StringTie FPKM: true outputs: - output_log: - element_tests: - GSM461177: - asserts: - - that: "has_text" - text: "Number of input reads |\t1051466" - - that: "has_text" - text: "Uniquely mapped reads number |\t871202" - - that: "has_text" - text: "Number of reads mapped to multiple loci |\t91808" - mapped-reads: - element_tests: - GSM461177: - asserts: - has_size: - value: 43037033 - delta: 4000000 - 'MultiQC on input dataset(s): Stats': - asserts: - has_line: - line: "Sample STAR_mqc_generalstats_star_total_reads_1 STAR_mqc_generalstats_star_mapped_1 STAR_mqc_generalstats_star_mapped_percent_1 STAR_mqc_generalstats_star_uniquely_mapped_1 STAR_mqc_generalstats_star_uniquely_mapped_percent_1 STAR_mqc_generalstats_star_multimapped_1 Cutadapt_mqc_generalstats_cutadapt_percent_trimmed" - has_text_matching: - expression: "GSM461177\t1.0[0-9]*\t0.96[0-9]*\t91.[0-9]*\t0.8[0-9]*\t82.8[0-9]*\t0.091[0-9]*\t4.0[0-9]*" - MultiQC webpage: + MultiQC stats: asserts: - - that: "has_text" - text: "GSM461177" - - that: "has_text" - text: "Filtered Reads" - - that: "has_text" - text: "STAR" - reads_per_gene from STAR: + has_text_matching: + expression: "SRR5085167\t0.11[0-9]*\t18.3[0-9]*\t69.6[0-9]*\t0.3[0-9]*\t0.3[0-9]*\t94.62\t0.12[0-9]*\t34.43\t0.2[0-9]*\t28.[0-9]*\t90.[0-9]*\t16.[0-9]*\t0.36[0-9]*\t43.[0-9]*\t91.[0-9]*\t70.[0-9]*\t36.[0-9]*\t46.0\t75.0\t75\t27.27[0-9]*\t0.39[0-9]*" + Counts Table: element_tests: - GSM461177: + SRR5085167: asserts: - - that: "has_text" - text: "N_ambiguous\t20961\t5272\t4705" - - that: "has_text" - text: "FBgn0010247\t14\t6\t8" - HTS count like output: + has_line: + line: "YAL038W 1775" + Mapped Reads: element_tests: - GSM461177: + SRR5085167: asserts: - has_text: - text: "FBgn0010247\t14" - transcripts_expression_cufflinks: + has_size: + value: 31570787 + delta: 3000000 + Gene Abundance Estimates from StringTie: element_tests: - GSM461177: + SRR5085167: asserts: - has_text: - text: "FBtr0078104\t-\t-\tFBgn0031217\tCG11377\t-\tchr2L:102379-104142\t1583\t0.626702\t18.291\t9.78605\t26.796\tOK" - genes_expression_cufflinks: + has_text_matching: + expression: "YAL038W\tCDC19\tchrI\t\\+\t71786\t73288\t57.[0-9]*\t3575.[0-9]*\t3084.[0-9]*" + Genes Expression from Cufflinks: element_tests: - GSM461177: + SRR5085167: asserts: - has_text_matching: - expression: "FBgn0031217\t-\t-\tFBgn0031217\tCG11377\t-\tchr2L:102379-104142\t-\t-\t32.1016\t22.1771\t42.02[0-9]*\tOK" - genes_expression_stringtie: + has_line: + line: "YAL038W - - YAL038W CDC19 - chrI:71785-73288 - - 3375.85 3161.36 3590.33 OK" + Transcripts Expression from Cufflinks: element_tests: - GSM461177: + SRR5085167: asserts: - has_text: - text: "FBgn0031220\tCG4822\tchr2L\t-\t116970\t121754\t1.067492\t36.649773\t74.784904" - both strands coverage: + has_line: + line: "YAL038W_mRNA - - YAL038W CDC19 - chrI:71785-73288 1503 57.5601 3375.85 3161.36 3590.33 OK" + Stranded Coverage: element_tests: - GSM461177: + SRR5085167_forward: asserts: has_size: - value: 6075761 - delta: 600000 - stranded coverage: - element_tests: - GSM461177_reverse: + value: 555489 + delta: 50000 + SRR5085167_reverse: asserts: has_size: - value: 3103918 - delta: 300000 - GSM461177_forward: + value: 526952 + delta: 50000 + Unstranded Coverage: + element_tests: + SRR5085167: asserts: has_size: - value: 3103918 - delta: 300000 + value: 978542 + delta: 90000 diff --git a/workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga b/workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga index 509d68a0d..9ca98ea25 100644 --- a/workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga +++ b/workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga @@ -1,18 +1,89 @@ { "a_galaxy_workflow": "true", - "annotation": "This workflow takes as input a list of single-reads fastqs. Adapters and bad quality bases are removed with cutadapt. Reads are mapped with STAR with ENCODE parameters and genes are counted simultaneously as well as normalized coverage (per million mapped reads) on uniquely mapped reads. The counts are reprocessed to be similar to HTSeq-count output. FPKM are computed with cufflinks and/or with StringTie. The unstranded normalized coverage is computed with bedtools.", - "comments": [], + "annotation": "This workflow takes as input a list of single-end fastqs. Adapters and bad quality bases are removed with fastp. Reads are mapped with STAR with ENCODE parameters and genes are counted simultaneously as well as normalized coverage (per million mapped reads) on uniquely mapped reads. The counts are reprocessed to be similar to HTSeq-count output. Alternatively, featureCounts can be used to count the reads/fragments per gene. FPKM are computed with cufflinks and/or with StringTie. The unstranded normalized coverage is computed with bedtools.\n", + "comments": [ + { + "child_steps": [ + 12, + 20, + 21 + ], + "color": "yellow", + "data": { + "title": "Additional quantification" + }, + "id": 2, + "position": [ + 1391.2086321940171, + 1073.6999999999998 + ], + "size": [ + 860, + 716 + ], + "type": "frame" + }, + { + "child_steps": [ + 17, + 18 + ], + "color": "red", + "data": { + "title": "Coverage Files" + }, + "id": 1, + "position": [ + 1603.68749985966, + 0 + ], + "size": [ + 375, + 538 + ], + "type": "frame" + }, + { + "child_steps": [ + 13, + 14, + 15 + ], + "color": "lime", + "data": { + "title": "Map Strandedness parameter" + }, + "id": 0, + "position": [ + 855.5086321940169, + 1252.5 + ], + "size": [ + 251, + 558 + ], + "type": "frame" + } + ], "creator": [ { "class": "Person", - "identifier": "0000-0002-1964-4960", + "identifier": "https://orcid.org/0000-0002-1964-4960", "name": "Lucille Delisle" + }, + { + "class": "Person", + "identifier": "https://orcid.org/0000-0002-5192-126X", + "name": "Pavankumar Videm" } ], "format-version": "0.1", "license": "MIT", - "name": "RNAseq_SR", - "release": "0.9", + "release": "1.0", + "name": "RNA-seq for Single-read fastqs", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, "steps": { "0": { "annotation": "Should be a list of single-read RNA-seq fastqs", @@ -23,249 +94,303 @@ "inputs": [ { "description": "Should be a list of single-read RNA-seq fastqs", - "name": "SR fastq input" + "name": "Collection of FASTQ files" } ], - "label": "SR fastq input", + "label": "Collection of FASTQ files", "name": "Input dataset collection", "outputs": [], "position": { "left": 0, - "top": 354 + "top": 462.87500890145213 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", + "tool_state": "{\"optional\": false, \"tag\": \"\", \"collection_type\": \"list\"}", "tool_version": null, "type": "data_collection_input", - "uuid": "2fee2555-0a2f-4758-9011-3667db23f962", + "uuid": "020f7580-f647-471f-b210-dbf9dfcf80bf", "when": null, "workflow_outputs": [] }, "1": { - "annotation": "Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", + "annotation": "This is optional. If not provided, fastp will try to guess the sequence. If you want to specify, for Nextera use: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC, for TruSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", "content_id": null, "errors": null, "id": 1, "input_connections": {}, "inputs": [ { - "description": "Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", - "name": "forward_adapter" + "description": "This is optional. If not provided, fastp will try to guess the sequence. If you want to specify, for Nextera use: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC, for TruSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", + "name": "Forward adapter" } ], - "label": "forward_adapter", + "label": "Forward adapter", "name": "Input parameter", "outputs": [], "position": { - "left": 42.45001220703125, - "top": 430.91668701171875 + "left": 35.17186494140515, + "top": 567.328103383874 }, "tool_id": null, - "tool_state": "{\"parameter_type\": \"text\", \"optional\": false}", + "tool_state": "{\"parameter_type\": \"text\", \"optional\": true}", "tool_version": null, "type": "parameter_input", - "uuid": "124c7578-bdaa-445b-a756-326077f2567d", + "uuid": "6d1de206-97c4-41ba-8702-a980f748a689", "when": null, "workflow_outputs": [] }, "2": { - "annotation": "reference_genome", + "annotation": "Whether to compute additional QC like fastQC, gene body coverage etc...", "content_id": null, "errors": null, "id": 2, "input_connections": {}, "inputs": [ { - "description": "reference_genome", - "name": "reference_genome" + "description": "Whether to compute additional QC like fastQC, gene body coverage etc...", + "name": "Generate additional QC reports" } ], - "label": "reference_genome", + "label": "Generate additional QC reports", "name": "Input parameter", "outputs": [], "position": { - "left": 107.63336181640625, - "top": 522.134886401586 + "left": 114.671875, + "top": 764.5781339014521 }, "tool_id": null, - "tool_state": "{\"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_state": "{\"parameter_type\": \"boolean\", \"optional\": false}", "tool_version": null, "type": "parameter_input", - "uuid": "39f1c435-1e7c-48d6-9149-37671b7b07da", + "uuid": "bea331ce-d6fa-4312-8dce-a8b13bc4e77b", "when": null, "workflow_outputs": [] }, "3": { - "annotation": "gtf compatible with the reference_genome. Mind the UCSC/Ensembl differences in chromosome naming", + "annotation": "Select the reference genome", "content_id": null, "errors": null, "id": 3, "input_connections": {}, "inputs": [ { - "description": "gtf compatible with the reference_genome. Mind the UCSC/Ensembl differences in chromosome naming", - "name": "gtf" + "description": "Select the reference genome", + "name": "Reference genome" + } + ], + "label": "Reference genome", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 157.109375, + "top": 870.218728383874 + }, + "tool_id": null, + "tool_state": "{\"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "a72b29ae-65a7-4e4d-a996-2943ab5b02aa", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "GTF compatible with the reference genome. Mind the UCSC/Ensembl differences in chromosome naming.", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "GTF compatible with the reference genome. Mind the UCSC/Ensembl differences in chromosome naming.", + "name": "GTF file of annotation" } ], - "label": "gtf", + "label": "GTF file of annotation", "name": "Input dataset", "outputs": [], "position": { - "left": 125.60003662109375, - "top": 606.751585620336 + "left": 199.671875, + "top": 977.3906033838739 }, "tool_id": null, "tool_state": "{\"optional\": false, \"tag\": \"\"}", "tool_version": null, "type": "data_input", - "uuid": "b32d0b73-c827-46f9-8279-697487cd3c4c", + "uuid": "4987fd01-b72c-4bc0-9d49-a840a0d04b8e", "when": null, "workflow_outputs": [] }, - "4": { + "5": { "annotation": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence", "content_id": null, "errors": null, - "id": 4, + "id": 5, "input_connections": {}, "inputs": [ { "description": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence", - "name": "strandedness" + "name": "Strandedness" } ], - "label": "strandedness", + "label": "Strandedness", "name": "Input parameter", "outputs": [], "position": { - "left": 156.25, - "top": 667.118284839086 + "left": 251.890625, + "top": 1073.781228383874 }, "tool_id": null, "tool_state": "{\"restrictions\": [\"stranded - forward\", \"stranded - reverse\", \"unstranded\"], \"parameter_type\": \"text\", \"optional\": false}", "tool_version": null, "type": "parameter_input", - "uuid": "02b7890c-1d0d-493e-9943-3016f6594b46", + "uuid": "2ccf2242-dddd-45b6-8cea-746d9b5d49bc", "when": null, "workflow_outputs": [] }, - "5": { - "annotation": "Whether FPKM values should be computed with cufflinks", + "6": { + "annotation": "Use featureCounts tool instead of RNA STAR?", "content_id": null, "errors": null, - "id": 5, + "id": 6, "input_connections": {}, "inputs": [ { - "description": "Whether FPKM values should be computed with cufflinks", - "name": "cufflinks_FPKM" + "description": "Use featureCounts tool instead of RNA STAR?", + "name": "Use featureCounts for generating count tables" } ], - "label": "cufflinks_FPKM", + "label": "Use featureCounts for generating count tables", "name": "Input parameter", "outputs": [], "position": { - "left": 177.6500244140625, - "top": 735.4800895070166 + "left": 291.34375, + "top": 1173.124978383874 }, "tool_id": null, "tool_state": "{\"parameter_type\": \"boolean\", \"optional\": false}", "tool_version": null, "type": "parameter_input", - "uuid": "a80fd45c-4164-4b94-847c-dcef5441b92a", + "uuid": "f43d45e6-5692-41cb-8cfc-205dbeab1bd0", "when": null, "workflow_outputs": [] }, - "6": { - "annotation": "Could be a gtf with for example one entry for the chrM forward and one entry for the chrM reverse", + "7": { + "annotation": "Whether FPKM values should be computed with Cufflinks", "content_id": null, "errors": null, - "id": 6, + "id": 7, + "input_connections": {}, + "inputs": [ + { + "description": "Whether FPKM values should be computed with Cufflinks", + "name": "Compute Cufflinks FPKM" + } + ], + "label": "Compute Cufflinks FPKM", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 346.83340121591186, + "top": 1309.3879390873915 + }, + "tool_id": null, + "tool_state": "{\"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "78868cdb-baff-4388-a41a-a700259da1ed", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "It could be a GTF with for example one entry for the chrM forward and one entry for the chrM reverse", + "content_id": null, + "errors": null, + "id": 8, "input_connections": {}, "inputs": [ { - "description": "Could be a gtf with for example one entry for the chrM forward and one entry for the chrM reverse", - "name": "gtf with regions to exclude from FPKM normalization with Cufflinks" + "description": "It could be a GTF with for example one entry for the chrM forward and one entry for the chrM reverse", + "name": "GTF with regions to exclude from FPKM normalization with Cufflinks" } ], - "label": "gtf with regions to exclude from FPKM normalization with Cufflinks", + "label": "GTF with regions to exclude from FPKM normalization with Cufflinks", "name": "Input dataset", "outputs": [], "position": { - "left": 201.73333740234375, - "top": 809.5967887257666 + "left": 380.53912206977975, + "top": 1425.307227138327 }, "tool_id": null, "tool_state": "{\"optional\": true, \"tag\": \"\"}", "tool_version": null, "type": "data_input", - "uuid": "54a833b6-bb4a-48c2-b8d7-4c8bb0172ce7", + "uuid": "0d4e1623-adc9-4ff3-8156-7e1322b1e278", "when": null, "workflow_outputs": [] }, - "7": { + "9": { "annotation": "Whether FPKM values should be computed with StringTie", "content_id": null, "errors": null, - "id": 7, + "id": 9, "input_connections": {}, "inputs": [ { "description": "Whether FPKM values should be computed with StringTie", - "name": "stringtie_FPKM" + "name": "Compute StringTie FPKM" } ], - "label": "stringtie_FPKM", + "label": "Compute StringTie FPKM", "name": "Input parameter", "outputs": [], "position": { - "left": 245.88330078125, - "top": 926.4134391163916 + "left": 406.9259176995931, + "top": 1559.4856968335116 }, "tool_id": null, "tool_state": "{\"parameter_type\": \"boolean\", \"optional\": false}", "tool_version": null, "type": "parameter_input", - "uuid": "05bdc4bb-4988-42e6-b281-cbb826b96c7b", + "uuid": "056f11f4-bdd9-4361-b037-2c0822320cc2", "when": null, "workflow_outputs": [] }, - "8": { + "10": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.24.0+galaxy3", "errors": null, - "id": 8, + "id": 10, "input_connections": { - "library|input_1": { - "id": 0, + "single_paired|adapter_trimming_options|adapter_sequence1": { + "id": 1, "output_name": "output" }, - "library|r1|adapters_0|adapter_source|adapter": { - "id": 1, + "single_paired|in1": { + "id": 0, "output_name": "output" } }, "inputs": [ { - "description": "runtime parameter for tool Cutadapt", - "name": "library" + "description": "runtime parameter for tool fastp", + "name": "single_paired" } ], - "label": "Cutadapt (remove adapter + bad quality bases)", - "name": "Cutadapt", + "label": "remove adapters + bad quality bases", + "name": "fastp", "outputs": [ { "name": "out1", - "type": "fastqsanger" + "type": "input" }, { - "name": "report", - "type": "txt" + "name": "report_json", + "type": "json" } ], "position": { - "left": 500.61669921875, - "top": 339.134886401586 + "left": 377, + "top": 106.21400000000001 }, "post_job_actions": { "HideDatasetActionout1": { @@ -273,39 +398,84 @@ "action_type": "HideDatasetAction", "output_name": "out1" }, - "HideDatasetActionout_pairs": { + "HideDatasetActionreport_json": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "out_pairs" - }, - "HideDatasetActionreport": { + "output_name": "report_json" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.24.0+galaxy3", + "tool_shed_repository": { + "changeset_revision": "a626e8c0e1ba", + "name": "fastp", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter_options\": {\"quality_filtering_options\": {\"disable_quality_filtering\": false, \"qualified_quality_phred\": \"30\", \"unqualified_percent_limit\": null, \"n_base_limit\": null}, \"length_filtering_options\": {\"disable_length_filtering\": false, \"length_required\": \"15\", \"length_limit\": null}, \"low_complexity_filter\": {\"enable_low_complexity_filter\": false, \"complexity_threshold\": null}}, \"output_options\": {\"report_html\": false, \"report_json\": true}, \"overrepresented_sequence_analysis\": {\"overrepresentation_analysis\": false, \"overrepresentation_sampling\": null}, \"read_mod_options\": {\"polyg_tail_trimming\": {\"trimming_select\": \"\", \"__current_case__\": 1, \"poly_g_min_len\": null}, \"polyx_tail_trimming\": {\"polyx_trimming_select\": \"\", \"__current_case__\": 1}, \"umi_processing\": {\"umi\": false, \"umi_loc\": null, \"umi_len\": null, \"umi_prefix\": null}, \"cutting_by_quality_options\": {\"cut_by_quality5\": false, \"cut_by_quality3\": false, \"cut_window_size\": null, \"cut_mean_quality\": null}, \"base_correction_options\": {\"correction\": false}}, \"single_paired\": {\"single_paired_selector\": \"single\", \"__current_case__\": 0, \"in1\": {\"__class__\": \"RuntimeValue\"}, \"adapter_trimming_options\": {\"disable_adapter_trimming\": false, \"adapter_sequence1\": {\"__class__\": \"ConnectedValue\"}}, \"global_trimming_options\": {\"trim_front1\": null, \"trim_tail1\": null}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.24.0+galaxy3", + "type": "tool", + "uuid": "e31141cc-c8a5-4dde-882f-72c1b8aabe97", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 11, + "input_connections": { + "input_param_type|input_param": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "no additional QC", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 2139.879611894974, + "top": 184.34956182248365 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "report" + "output_name": "output_param_boolean" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "5eb7e84243f2", - "name": "cutadapt", - "owner": "lparsons", + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": []}}, \"other_trimming_options\": {\"cut\": \"0\", \"cut2\": \"0\", \"quality_cutoff\": \"30\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"strip_suffix\": \"\", \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "4.9+galaxy1", + "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"true\"}, {\"__index__\": 1, \"from\": true, \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.2.0", "type": "tool", - "uuid": "4d39b70d-c852-4c42-9e0d-f3641d632543", + "uuid": "68188ffa-f288-4da4-8d29-1f3d3b689937", "when": null, "workflow_outputs": [] }, - "9": { + "12": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", "errors": null, - "id": 9, + "id": 12, "input_connections": { "components_0|param_type|component_value": { - "id": 2, + "id": 3, "output_name": "output" } }, @@ -319,8 +489,8 @@ } ], "position": { - "left": 979.0166015625, - "top": 1004.2468131398291 + "left": 1497.7951400347756, + "top": 1173.104961480357 }, "post_job_actions": { "HideDatasetActionout1": { @@ -339,18 +509,18 @@ "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "0.1.1", "type": "tool", - "uuid": "87e88a77-d412-4ed0-8bf1-9c23406d4a22", + "uuid": "bcceb886-0592-4b3f-8b39-26fe79caeb62", "when": null, "workflow_outputs": [] }, - "10": { + "13": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 10, + "id": 13, "input_connections": { "input_param_type|input_param": { - "id": 4, + "id": 5, "output_name": "output" } }, @@ -360,7 +530,7 @@ "name": "input_param_type" } ], - "label": "awk command from strand", + "label": "Get featureCounts strandedness parameter", "name": "Map parameter value", "outputs": [ { @@ -369,8 +539,8 @@ } ], "position": { - "left": 1196.5, - "top": 814.2634757374854 + "left": 880.1168847150709, + "top": 1303.1637555172579 }, "post_job_actions": { "HideDatasetActionoutput_param_text": { @@ -386,21 +556,21 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"stranded - forward\", \"to\": \"NR>4{print $1\\\"\\\\t\\\"$3}\"}, {\"__index__\": 1, \"from\": \"stranded - reverse\", \"to\": \"NR>4{print $1\\\"\\\\t\\\"$4}\"}, {\"__index__\": 2, \"from\": \"unstranded\", \"to\": \"NR>4{print $1\\\"\\\\t\\\"$2}\"}]}, \"output_param_type\": \"text\", \"unmapped\": {\"on_unmapped\": \"fail\", \"__current_case__\": 1}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"stranded - forward\", \"to\": \"1\"}, {\"__index__\": 1, \"from\": \"stranded - reverse\", \"to\": \"2\"}, {\"__index__\": 2, \"from\": \"unstranded\", \"to\": \"0\"}]}, \"output_param_type\": \"text\", \"unmapped\": {\"on_unmapped\": \"fail\", \"__current_case__\": 1}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "0.2.0", "type": "tool", - "uuid": "dc27749f-07ad-454d-8b8d-15612b31870c", + "uuid": "72d7d4d1-d1be-481c-b2a1-1e85192b2661", "when": null, "workflow_outputs": [] }, - "11": { + "14": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 11, + "id": 14, "input_connections": { "input_param_type|input_param": { - "id": 4, + "id": 5, "output_name": "output" } }, @@ -410,7 +580,7 @@ "name": "input_param_type" } ], - "label": "Get cufflinks strandess parameter", + "label": "Get cufflinks strandedness parameter", "name": "Map parameter value", "outputs": [ { @@ -419,8 +589,8 @@ } ], "position": { - "left": 1010.4833984375, - "top": 1180.2257433107284 + "left": 880.334534933914, + "top": 1483.3515528952898 }, "post_job_actions": { "HideDatasetActionoutput_param_text": { @@ -439,18 +609,18 @@ "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"stranded - forward\", \"to\": \"fr-secondstrand\"}, {\"__index__\": 1, \"from\": \"stranded - reverse\", \"to\": \"fr-firststrand\"}, {\"__index__\": 2, \"from\": \"unstranded\", \"to\": \"fr-unstranded\"}]}, \"output_param_type\": \"text\", \"unmapped\": {\"on_unmapped\": \"fail\", \"__current_case__\": 1}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "0.2.0", "type": "tool", - "uuid": "d2d1af99-7b7b-4ec1-b2dc-5997fd3d702b", + "uuid": "f027f3d5-3b91-4061-b5cd-78553509ce5e", "when": null, "workflow_outputs": [] }, - "12": { + "15": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 12, + "id": 15, "input_connections": { "input_param_type|input_param": { - "id": 4, + "id": 5, "output_name": "output" } }, @@ -469,8 +639,8 @@ } ], "position": { - "left": 913.0522727953694, - "top": 1576.8436797276113 + "left": 875.5945006269037, + "top": 1653.5777444451405 }, "post_job_actions": { "HideDatasetActionoutput_param_text": { @@ -489,26 +659,26 @@ "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"stranded - forward\", \"to\": \"--fr\"}, {\"__index__\": 1, \"from\": \"stranded - reverse\", \"to\": \"--rf\"}, {\"__index__\": 2, \"from\": \"unstranded\", \"to\": \"\"}]}, \"output_param_type\": \"text\", \"unmapped\": {\"on_unmapped\": \"fail\", \"__current_case__\": 1}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "0.2.0", "type": "tool", - "uuid": "c04f4059-e125-46b4-9a85-446dd6f0a08b", + "uuid": "63e6501b-e1de-4184-af42-720cc9a6dfb0", "when": null, "workflow_outputs": [] }, - "13": { + "16": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.11a+galaxy1", "errors": null, - "id": 13, + "id": 16, "input_connections": { "refGenomeSource|GTFconditional|genomeDir": { - "id": 2, + "id": 3, "output_name": "output" }, "refGenomeSource|GTFconditional|sjdbGTFfile": { - "id": 3, + "id": 4, "output_name": "output" }, "singlePaired|input1": { - "id": 8, + "id": 10, "output_name": "out1" } }, @@ -555,10 +725,20 @@ } ], "position": { - "left": 819.25, - "top": 335.9166717529297 + "left": 732.1609477893844, + "top": 246.8799136582777 }, "post_job_actions": { + "HideDatasetActionoutput_log": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_log" + }, + "HideDatasetActionreads_per_gene": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "reads_per_gene" + }, "HideDatasetActionsignal_unique_str1": { "action_arguments": {}, "action_type": "HideDatasetAction", @@ -583,6 +763,20 @@ "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "splice_junctions" + }, + "RenameDatasetActionmapped_reads": { + "action_arguments": { + "newname": "Mapped Reads" + }, + "action_type": "RenameDatasetAction", + "output_name": "mapped_reads" + }, + "RenameDatasetActionreads_per_gene": { + "action_arguments": { + "newname": "Reads per gene from STAR" + }, + "action_type": "RenameDatasetAction", + "output_name": "reads_per_gene" } }, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.11a+galaxy1", @@ -595,120 +789,43 @@ "tool_state": "{\"algo\": {\"params\": {\"settingsType\": \"full\", \"__current_case__\": 3, \"seed\": {\"seedSearchStartLmax\": \"50\", \"seedSearchStartLmaxOverLread\": \"1.0\", \"seedSearchLmax\": \"0\", \"seedMultimapNmax\": \"10000\", \"seedPerReadNmax\": \"1000\", \"seedPerWindowNmax\": \"50\", \"seedNoneLociPerWindow\": \"10\"}, \"align\": {\"alignIntronMin\": \"20\", \"alignIntronMax\": \"1000000\", \"alignMatesGapMax\": \"1000000\", \"alignSJoverhangMin\": \"8\", \"alignSJstitchMismatchNmax\": {\"alignSJstitchMismatchNmax1\": \"0\", \"alignSJstitchMismatchNmax2\": \"-1\", \"alignSJstitchMismatchNmax3\": \"0\", \"alignSJstitchMismatchNmax4\": \"0\"}, \"alignSJDBoverhangMin\": \"1\", \"alignSplicedMateMapLmin\": \"0\", \"alignSplicedMateMapLminOverLmate\": \"0.66\", \"alignWindowsPerReadNmax\": \"10000\", \"alignTranscriptsPerWindowNmax\": \"100\", \"alignTranscriptsPerReadNmax\": \"10000\", \"alignEndsType\": \"Local\", \"peOverlapNbasesMin\": \"0\", \"peOverlapMMp\": \"0.01\"}, \"chim_settings\": {\"chimSegmentMin\": \"12\", \"chimScoreMin\": \"0\", \"chimScoreDropMax\": \"20\", \"chimScoreSeparation\": \"10\", \"chimScoreJunctionNonGTAG\": \"-1\", \"chimJunctionOverhangMin\": \"20\", \"chimSegmentReadGapMax\": \"0\", \"chimFilter\": true, \"chimMainSegmentMultNmax\": \"10\", \"chimMultimapNmax\": \"1\", \"chimMultimapScoreRange\": \"1\"}, \"junction_limits\": {\"limitOutSJoneRead\": \"1000\", \"limitOutSJcollapsed\": \"1000000\", \"limitSjdbInsertNsj\": \"1000000\"}}}, \"chimOutType\": \"\", \"filter\": {\"basic_filters\": [\"exclude_unmapped\"], \"output_params2\": {\"output_select2\": \"yes\", \"__current_case__\": 0, \"outFilterType\": true, \"outFilterMultimapScoreRange\": \"1\", \"outFilterMultimapNmax\": \"20\", \"outFilterMismatchNmax\": \"999\", \"outFilterMismatchNoverLmax\": \"0.3\", \"outFilterMismatchNoverReadLmax\": \"0.04\", \"outFilterScoreMin\": \"0\", \"outFilterScoreMinOverLread\": \"0.66\", \"outFilterMatchNmin\": \"0\", \"outFilterMatchNminOverLread\": \"0.66\", \"outSAMmultNmax\": \"-1\", \"outSAMtlen\": \"1\"}}, \"oformat\": {\"outSAMattributes\": [\"NH\", \"HI\", \"AS\", \"nM\"], \"HI_offset\": \"1\", \"outSAMprimaryFlag\": \"OneBestScore\", \"outSAMmapqUnique\": \"255\", \"wasp_conditional\": {\"waspOutputMode\": \"\", \"__current_case__\": 1}}, \"outWig\": {\"outWigType\": \"bedGraph\", \"__current_case__\": 1, \"outWigTypeSecondWord\": \"\", \"outWigStrand\": true, \"outWigReferencesPrefix\": \"-\", \"outWigNorm\": true}, \"perf\": {\"outBAMsortingBinsN\": \"50\", \"winAnchorMultimapNmax\": \"50\"}, \"refGenomeSource\": {\"geneSource\": \"indexed\", \"__current_case__\": 0, \"GTFconditional\": {\"GTFselect\": \"without-gtf-with-gtf\", \"__current_case__\": 1, \"genomeDir\": {\"__class__\": \"ConnectedValue\"}, \"sjdbGTFfile\": {\"__class__\": \"ConnectedValue\"}, \"sjdbGTFfeatureExon\": \"exon\", \"sjdbOverhang\": \"100\", \"quantmode_output\": {\"quantMode\": \"GeneCounts\", \"__current_case__\": 1}}}, \"singlePaired\": {\"sPaired\": \"single\", \"__current_case__\": 0, \"input1\": {\"__class__\": \"ConnectedValue\"}}, \"twopass\": {\"twopassMode\": \"None\", \"__current_case__\": 0, \"twopass_read_subset\": \"\", \"sj_precalculated\": \"\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.7.11a+galaxy1", "type": "tool", - "uuid": "8a26e154-29c0-426a-b0aa-215192f03596", + "uuid": "be1a277d-6d0d-4aaf-acea-9735426932b0", "when": null, "workflow_outputs": [ { - "label": "output_log", - "output_name": "output_log", - "uuid": "4cb18b88-63ab-4881-afec-d6569dbd3533" - }, - { - "label": "reads_per_gene from STAR", - "output_name": "reads_per_gene", - "uuid": "056b9f4b-5208-4885-97e8-474f417537ee" - }, - { - "label": "mapped-reads", + "label": "Mapped Reads", "output_name": "mapped_reads", - "uuid": "94cb795a-4fa6-4323-af7d-99c346e83435" + "uuid": "f5722954-fd5c-4e66-aed0-4cd099dd9b1c" } ] }, - "14": { + "17": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", - "errors": null, - "id": 14, + "id": 17, "input_connections": { - "results_0|software_cond|input": { - "id": 8, - "output_name": "report" + "STAR BAM": { + "id": 16, + "input_subworkflow_step_id": 1, + "output_name": "mapped_reads" }, - "results_1|software_cond|output_0|type|input": { - "id": 13, + "STAR log": { + "id": 16, + "input_subworkflow_step_id": 0, "output_name": "output_log" - }, - "results_1|software_cond|output_1|type|input": { - "id": 13, - "output_name": "reads_per_gene" } }, - "inputs": [], - "label": "MultiQC", - "name": "MultiQC", - "outputs": [ - { - "name": "plots", - "type": "input" - }, - { - "name": "html_report", - "type": "html" - }, + "inputs": [ { - "name": "stats", - "type": "tabular" + "description": "", + "name": "Generate Unstranded Coverage" } ], + "label": "Generate Unstranded Coverage", + "name": "Get Uniquely mapped unstranded coverage", + "outputs": [], "position": { - "left": 1195.211542597603, - "top": 0 - }, - "post_job_actions": { - "HideDatasetActionplots": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "plots" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", - "tool_shed_repository": { - "changeset_revision": "f7e2f1eb3a16", - "name": "multiqc", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"star\", \"__current_case__\": 28, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"log\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"type\": {\"type\": \"genecounts\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}], \"saveLog\": \"false\", \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.24.1+galaxy0", - "type": "tool", - "uuid": "ba4d9ac2-f8b6-43bc-bc5f-e542c44441cd", - "when": null, - "workflow_outputs": [ - { - "label": "MultiQC webpage", - "output_name": "html_report", - "uuid": "24fe0860-563a-4938-b51d-6fdf10ec4175" - }, - { - "label": "MultiQC on input dataset(s): Stats", - "output_name": "stats", - "uuid": "4036a639-8e11-4de6-873f-a60183b789df" - } - ] - }, - "15": { - "annotation": "", - "id": 15, - "input_connections": { - "STAR BAM": { - "id": 13, - "input_subworkflow_step_id": 0, - "output_name": "mapped_reads" - }, - "STAR log": { - "id": 13, - "input_subworkflow_step_id": 1, - "output_name": "output_log" - } - }, - "inputs": [], - "label": null, - "name": "Get Uniquely mapped unstranded coverage", - "outputs": [], - "position": { - "left": 1134, - "top": 420 + "left": 1683.2031849964808, + "top": 86.70584740647254 }, "subworkflow": { "a_galaxy_workflow": "true", @@ -724,157 +841,160 @@ "format-version": "0.1", "license": "MIT", "name": "Get Uniquely mapped unstranded coverage", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, "steps": { "0": { - "annotation": "", + "annotation": "RNA STAR log files", "content_id": null, "errors": null, "id": 0, "input_connections": {}, "inputs": [ { - "description": "", - "name": "STAR BAM" + "description": "RNA STAR log files", + "name": "STAR log" } ], - "label": "STAR BAM", + "label": "STAR log", "name": "Input dataset collection", "outputs": [], "position": { "left": 0, - "top": 45.91668701171875 + "top": 46 }, "tool_id": null, "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", "tool_version": null, "type": "data_collection_input", - "uuid": "8688442b-cd63-46b3-8f36-a02e11091e4c", + "uuid": "3e3f7463-a635-44a2-a1f4-7e12aae3d25b", "when": null, "workflow_outputs": [] }, "1": { - "annotation": "", + "annotation": "Mapped BAM files generate from RNA STAR", "content_id": null, "errors": null, "id": 1, "input_connections": {}, "inputs": [ { - "description": "", - "name": "STAR log" + "description": "Mapped BAM files generate from RNA STAR", + "name": "STAR BAM" } ], - "label": "STAR log", + "label": "STAR BAM", "name": "Input dataset collection", "outputs": [], "position": { - "left": 40, - "top": 259.91668701171875 + "left": 280, + "top": 209 }, "tool_id": null, "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", "tool_version": null, "type": "data_collection_input", - "uuid": "e97ce94f-3ccb-4abf-ab75-8b76c7cb1762", + "uuid": "10dddc85-d3fc-4cba-a637-0c40153d284f", "when": null, "workflow_outputs": [] }, "2": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.2+galaxy2", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1", "errors": null, "id": 2, "input_connections": { - "input_bam": { + "infile": { "id": 0, "output_name": "output" } }, "inputs": [], - "label": "keep uniquely mapped reads", - "name": "Filter BAM", + "label": "get scaling factor", + "name": "Text reformatting", "outputs": [ { - "name": "out_file2", - "type": "txt" - }, - { - "name": "out_file1", - "type": "bam" + "name": "outfile", + "type": "input" } ], "position": { - "left": 260.4666748046875, - "top": 0 + "left": 280, + "top": 20 }, "post_job_actions": { - "HideDatasetActionout_file1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "out_file1" - }, - "HideDatasetActionout_file2": { + "HideDatasetActionoutfile": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "out_file2" + "output_name": "outfile" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.2+galaxy2", + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1", "tool_shed_repository": { - "changeset_revision": "993b19f20c76", - "name": "bamtools_filter", - "owner": "devteam", + "changeset_revision": "86755160afbf", + "name": "text_processing", + "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"conditions\": [{\"__index__\": 0, \"filters\": [{\"__index__\": 0, \"bam_property\": {\"bam_property_selector\": \"tag\", \"__current_case__\": 21, \"bam_property_value\": \"NH=1\"}}]}], \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"rule_configuration\": {\"rules_selector\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.5.2+galaxy2", + "tool_state": "{\"code\": \"$0~\\\"Uniquely mapped reads number\\\"{print 1000000/$NF}\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "9.3+galaxy1", "type": "tool", - "uuid": "8b2522f8-237b-4bb0-8429-94c029a1c9d8", + "uuid": "77cf2304-36bf-4337-bc2d-bc4d8b831668", "when": null, "workflow_outputs": [] }, "3": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.2+galaxy2", "errors": null, "id": 3, "input_connections": { - "infile": { + "input_bam": { "id": 1, "output_name": "output" } }, "inputs": [], - "label": "get scaling factor", - "name": "Text reformatting", + "label": "keep uniquely mapped reads", + "name": "Filter BAM", "outputs": [ { - "name": "outfile", - "type": "input" + "name": "out_file2", + "type": "txt" + }, + { + "name": "out_file1", + "type": "bam" } ], "position": { - "left": 319.4666748046875, - "top": 300 + "left": 560, + "top": 195 }, "post_job_actions": { - "HideDatasetActionoutfile": { + "HideDatasetActionout_file1": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "outfile" + "output_name": "out_file1" + }, + "HideDatasetActionout_file2": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file2" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.2+galaxy2", "tool_shed_repository": { - "changeset_revision": "86755160afbf", - "name": "text_processing", - "owner": "bgruening", + "changeset_revision": "993b19f20c76", + "name": "bamtools_filter", + "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"code\": \"$0~\\\"Uniquely mapped reads number\\\"{print 1000000/$NF}\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "9.3+galaxy1", + "tool_state": "{\"conditions\": [{\"__index__\": 0, \"filters\": [{\"__index__\": 0, \"bam_property\": {\"bam_property_selector\": \"tag\", \"__current_case__\": 21, \"bam_property_value\": \"NH=1\"}}]}], \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"rule_configuration\": {\"rules_selector\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.5.2+galaxy2", "type": "tool", - "uuid": "12b386f6-5254-4389-9400-4fe5381b3336", + "uuid": "59db7088-85bf-42ba-9dcd-76836f9d6310", "when": null, "workflow_outputs": [] }, @@ -885,7 +1005,7 @@ "id": 4, "input_connections": { "input1": { - "id": 3, + "id": 2, "output_name": "outfile" } }, @@ -899,8 +1019,8 @@ } ], "position": { - "left": 584.4666748046875, - "top": 327 + "left": 560, + "top": 0 }, "post_job_actions": { "HideDatasetActionfloat_param": { @@ -913,7 +1033,7 @@ "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"float\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "0.1.0", "type": "tool", - "uuid": "2c5c3ff1-a96f-4002-937c-d0560c1b190f", + "uuid": "83e6d856-5809-419a-b4bc-639662a95751", "when": null, "workflow_outputs": [] }, @@ -924,7 +1044,7 @@ "id": 5, "input_connections": { "input_type|input": { - "id": 2, + "id": 3, "output_name": "out_file1" }, "report|scale": { @@ -951,8 +1071,8 @@ } ], "position": { - "left": 855.418361599966, - "top": 226.99244090393722 + "left": 840, + "top": 12 }, "post_job_actions": { "HideDatasetActionoutput": { @@ -971,7 +1091,7 @@ "tool_state": "{\"d\": false, \"dz\": false, \"five\": false, \"input_type\": {\"input_type_select\": \"bam\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}, \"report\": {\"report_select\": \"bg\", \"__current_case__\": 0, \"zero_regions\": false, \"scale\": {\"__class__\": \"ConnectedValue\"}}, \"split\": true, \"strand\": \"\", \"three\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.31.1", "type": "tool", - "uuid": "6a733bff-0f07-454f-9e07-1abd649f8ab6", + "uuid": "df53e789-be2d-4b09-be8d-a07a35c14913", "when": null, "workflow_outputs": [] }, @@ -996,13 +1116,13 @@ } ], "position": { - "left": 1104.4183615999664, - "top": 298.7166748046875 + "left": 1120, + "top": 67 }, "post_job_actions": { "RenameDatasetActionout_file1": { "action_arguments": { - "newname": "both strands coverage" + "newname": "Both Strands Coverage" }, "action_type": "RenameDatasetAction", "output_name": "out_file1" @@ -1012,59 +1132,64 @@ "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "1.1.1", "type": "tool", - "uuid": "518f3e4f-cef7-4c50-936f-661873aee1d4", + "uuid": "62d76728-f614-48c0-9560-3abd05b8366d", "when": null, "workflow_outputs": [ { - "label": "both strands coverage", + "label": "Both Strands Coverage", "output_name": "out_file1", - "uuid": "69f8c8e8-85d2-42c5-8b28-f7ba79dbcfa7" + "uuid": "73763ad9-c132-4764-ada6-eece0c30e74f" } ] } }, "tags": [], - "uuid": "d629f889-14c9-4a3f-bf9f-1b31117e3191" + "uuid": "451bba09-1c21-4978-b693-4e64402c5787" }, "tool_id": null, "type": "subworkflow", - "uuid": "093c0e8d-69f6-4bf9-9277-3e4183be1988", + "uuid": "6ce6314b-d339-40bf-9f0e-53ca525204be", "when": null, "workflow_outputs": [ { - "label": "both strands coverage", - "output_name": "both strands coverage", - "uuid": "0ee924f9-48e4-406a-b7e2-dd14a8e1640f" + "label": "Unstranded Coverage", + "output_name": "Both Strands Coverage", + "uuid": "f90cc885-438b-49ee-b1d1-8ed45f7dea5c" } ] }, - "16": { + "18": { "annotation": "", - "id": 16, + "id": 18, "input_connections": { "Bedgraph strand 1": { - "id": 13, + "id": 16, "input_subworkflow_step_id": 1, "output_name": "signal_unique_str1" }, "Bedgraph strand 2": { - "id": 13, + "id": 16, "input_subworkflow_step_id": 2, "output_name": "signal_unique_str2" }, "strandedness": { - "id": 4, + "id": 5, "input_subworkflow_step_id": 0, "output_name": "output" } }, - "inputs": [], - "label": null, + "inputs": [ + { + "description": "", + "name": "Generate Stranded Coverage" + } + ], + "label": "Generate Stranded Coverage", "name": "Re-arrange Stranded RNA-seq coverage", "outputs": [], "position": { - "left": 1144, - "top": 591 + "left": 1692.210489743303, + "top": 282.0471550654421 }, "subworkflow": { "a_galaxy_workflow": "true", @@ -1080,6 +1205,9 @@ "format-version": "0.1", "license": "MIT", "name": "Re-arrange Stranded RNA-seq coverage", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, "steps": { "0": { "annotation": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence", @@ -1098,31 +1226,31 @@ "outputs": [], "position": { "left": 0, - "top": 86.19999694824209 + "top": 370 }, "tool_id": null, "tool_state": "{\"restrictions\": [\"stranded - forward\", \"stranded - reverse\", \"unstranded\"], \"parameter_type\": \"text\", \"optional\": false}", "tool_version": null, "type": "parameter_input", - "uuid": "1865e89f-6f75-4bef-a34f-65c44f68eb83", + "uuid": "56955f25-7e9e-4201-a056-b61f47359c84", "when": null, "workflow_outputs": [ { "label": null, "output_name": "output", - "uuid": "d9eef145-06bd-44e9-b2e5-ba276897fd0f" + "uuid": "d363c181-7f37-45ef-9732-86aaf879478a" } ] }, "1": { - "annotation": "", + "annotation": "From STAR strand 1", "content_id": null, "errors": null, "id": 1, "input_connections": {}, "inputs": [ { - "description": "", + "description": "From STAR strand 1", "name": "Bedgraph strand 1" } ], @@ -1130,14 +1258,14 @@ "name": "Input dataset collection", "outputs": [], "position": { - "left": 62.75, - "top": 182.01666259765614 + "left": 0, + "top": 472 }, "tool_id": null, "tool_state": "{\"optional\": false, \"format\": [\"bedgraph\"], \"tag\": null, \"collection_type\": \"list\"}", "tool_version": null, "type": "data_collection_input", - "uuid": "480154cb-4343-4ed2-b106-9c20032aca7f", + "uuid": "7919f2ed-554a-4e08-93eb-6896a2195293", "when": null, "workflow_outputs": [] }, @@ -1157,14 +1285,14 @@ "name": "Input dataset collection", "outputs": [], "position": { - "left": 124.7500000000002, - "top": 291.0166625976562 + "left": 569.999952609169, + "top": 0 }, "tool_id": null, "tool_state": "{\"optional\": false, \"format\": [\"bedgraph\"], \"tag\": null, \"collection_type\": \"list\"}", "tool_version": null, "type": "data_collection_input", - "uuid": "99862f93-3061-4074-bb86-486b8bbf6009", + "uuid": "9318223c-4443-4341-8448-11df606ccfdf", "when": null, "workflow_outputs": [] }, @@ -1185,7 +1313,7 @@ "name": "input_param_type" } ], - "label": "Get replacement for strand1", + "label": "Get replacement for strand2", "name": "Map parameter value", "outputs": [ { @@ -1194,8 +1322,8 @@ } ], "position": { - "left": 445, - "top": 105 + "left": 289.9999763045845, + "top": 51 }, "post_job_actions": { "HideDatasetActionoutput_param_boolean": { @@ -1216,10 +1344,10 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"stranded - forward\", \"to\": \"$1_forward\"}, {\"__index__\": 1, \"from\": \"stranded - reverse\", \"to\": \"$1_reverse\"}, {\"__index__\": 2, \"from\": \"unstranded\", \"to\": \"$1_forward\"}]}, \"output_param_type\": \"text\", \"unmapped\": {\"on_unmapped\": \"fail\", \"__current_case__\": 1}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"stranded - forward\", \"to\": \"$1_reverse\"}, {\"__index__\": 1, \"from\": \"stranded - reverse\", \"to\": \"$1_forward\"}, {\"__index__\": 2, \"from\": \"unstranded\", \"to\": \"$1_reverse\"}]}, \"output_param_type\": \"text\", \"unmapped\": {\"on_unmapped\": \"fail\", \"__current_case__\": 1}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "0.2.0", "type": "tool", - "uuid": "22cf84f4-9cc7-49aa-a568-39b8716311a5", + "uuid": "2ec50fce-ef76-4f56-9fc6-5c6b34c6593e", "when": null, "workflow_outputs": [] }, @@ -1240,7 +1368,7 @@ "name": "input_param_type" } ], - "label": "Get replacement for strand2", + "label": "Get replacement for strand1", "name": "Map parameter value", "outputs": [ { @@ -1249,8 +1377,8 @@ } ], "position": { - "left": 491, - "top": 283 + "left": 289.9999763045845, + "top": 359 }, "post_job_actions": { "HideDatasetActionoutput_param_boolean": { @@ -1271,10 +1399,10 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"stranded - forward\", \"to\": \"$1_reverse\"}, {\"__index__\": 1, \"from\": \"stranded - reverse\", \"to\": \"$1_forward\"}, {\"__index__\": 2, \"from\": \"unstranded\", \"to\": \"$1_reverse\"}]}, \"output_param_type\": \"text\", \"unmapped\": {\"on_unmapped\": \"fail\", \"__current_case__\": 1}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"stranded - forward\", \"to\": \"$1_forward\"}, {\"__index__\": 1, \"from\": \"stranded - reverse\", \"to\": \"$1_reverse\"}, {\"__index__\": 2, \"from\": \"unstranded\", \"to\": \"$1_forward\"}]}, \"output_param_type\": \"text\", \"unmapped\": {\"on_unmapped\": \"fail\", \"__current_case__\": 1}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "0.2.0", "type": "tool", - "uuid": "d6c2ce80-2927-4a4f-beab-2afd85b899f0", + "uuid": "b7e2cedf-e846-4553-9e48-4aa9a93d40b2", "when": null, "workflow_outputs": [] }, @@ -1299,8 +1427,8 @@ } ], "position": { - "left": 351.00000000000017, - "top": 0 + "left": 289.9999763045845, + "top": 225 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", @@ -1313,7 +1441,7 @@ "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "0.0.2", "type": "tool", - "uuid": "1fd86b13-3273-4a95-9b38-657ede0cb1a5", + "uuid": "7d866aad-dd6c-4d17-bf6d-8f0026652265", "when": null, "workflow_outputs": [] }, @@ -1333,7 +1461,7 @@ } }, "inputs": [], - "label": "New labels strand 1", + "label": "New labels strand 2", "name": "Replace", "outputs": [ { @@ -1342,8 +1470,8 @@ } ], "position": { - "left": 782, - "top": 76 + "left": 569.999952609169, + "top": 123 }, "post_job_actions": { "HideDatasetActionoutfile": { @@ -1362,7 +1490,7 @@ "tool_state": "{\"find_and_replace\": [{\"__index__\": 0, \"find_pattern\": \"^(.+)$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"is_regex\": true, \"global\": true, \"caseinsensitive\": false, \"wholewords\": false, \"skip_first_line\": false, \"searchwhere\": {\"searchwhere_select\": \"line\", \"__current_case__\": 0}}], \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "9.3+galaxy1", "type": "tool", - "uuid": "930e865a-bafd-4f20-81fd-c008d781b7d2", + "uuid": "ec10a98b-adb9-4037-9137-1717068d7157", "when": null, "workflow_outputs": [] }, @@ -1382,7 +1510,7 @@ } }, "inputs": [], - "label": "New labels strand 2", + "label": "New labels strand 1", "name": "Replace", "outputs": [ { @@ -1391,8 +1519,8 @@ } ], "position": { - "left": 821, - "top": 276 + "left": 569.999952609169, + "top": 328 }, "post_job_actions": { "HideDatasetActionoutfile": { @@ -1411,7 +1539,7 @@ "tool_state": "{\"find_and_replace\": [{\"__index__\": 0, \"find_pattern\": \"^(.+)$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"is_regex\": true, \"global\": true, \"caseinsensitive\": false, \"wholewords\": false, \"skip_first_line\": false, \"searchwhere\": {\"searchwhere_select\": \"line\", \"__current_case__\": 0}}], \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "9.3+galaxy1", "type": "tool", - "uuid": "7f9c10e6-8f19-4467-9549-641668c84812", + "uuid": "4eb0d67c-f53c-4f84-90fc-3db41e4f0aa7", "when": null, "workflow_outputs": [] }, @@ -1426,7 +1554,7 @@ "output_name": "outfile" }, "input": { - "id": 1, + "id": 2, "output_name": "output" } }, @@ -1436,7 +1564,7 @@ "name": "how" } ], - "label": "Relabelled strand 1", + "label": "Relabelled strand 2", "name": "Relabel identifiers", "outputs": [ { @@ -1445,8 +1573,8 @@ } ], "position": { - "left": 1056, - "top": 176.99999999999994 + "left": 849.9998437853558, + "top": 106 }, "post_job_actions": { "HideDatasetActionoutput": { @@ -1459,7 +1587,7 @@ "tool_state": "{\"how\": {\"how_select\": \"txt\", \"__current_case__\": 0, \"labels\": {\"__class__\": \"ConnectedValue\"}, \"strict\": false}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "1.0.0", "type": "tool", - "uuid": "89b5768c-6f33-403a-98ca-efcdb302e65a", + "uuid": "147ccbb0-b951-4851-9bf5-2c6b439ac1b6", "when": null, "workflow_outputs": [] }, @@ -1474,7 +1602,7 @@ "output_name": "outfile" }, "input": { - "id": 2, + "id": 1, "output_name": "output" } }, @@ -1484,7 +1612,7 @@ "name": "how" } ], - "label": "Relabelled strand 2", + "label": "Relabelled strand 1", "name": "Relabel identifiers", "outputs": [ { @@ -1493,8 +1621,8 @@ } ], "position": { - "left": 1077, - "top": 324.99999999999994 + "left": 849.9999005376209, + "top": 365 }, "post_job_actions": { "HideDatasetActionoutput": { @@ -1507,7 +1635,7 @@ "tool_state": "{\"how\": {\"how_select\": \"txt\", \"__current_case__\": 0, \"labels\": {\"__class__\": \"ConnectedValue\"}, \"strict\": false}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "1.0.0", "type": "tool", - "uuid": "554d85f6-7c54-44f7-a9f4-9b0d2d9737f6", + "uuid": "e9dcd2df-2834-4e9a-bef2-7666de012b8a", "when": null, "workflow_outputs": [] }, @@ -1518,11 +1646,11 @@ "id": 10, "input_connections": { "inputs_0|input": { - "id": 8, + "id": 9, "output_name": "output" }, "inputs_1|input": { - "id": 9, + "id": 8, "output_name": "output" } }, @@ -1536,8 +1664,8 @@ } ], "position": { - "left": 1360.7832000000906, - "top": 265.99999999999994 + "left": 1129.9999903467356, + "top": 120 }, "post_job_actions": { "HideDatasetActionoutput": { @@ -1550,7 +1678,7 @@ "tool_state": "{\"advanced\": {\"conflict\": {\"duplicate_options\": \"keep_first\", \"__current_case__\": 3}}, \"inputs\": [{\"__index__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "1.0.0", "type": "tool", - "uuid": "e3c1b832-2f79-4ce4-94d2-4e6396e569e3", + "uuid": "f47d7381-13b2-4615-b947-17a0ac2ad500", "when": null, "workflow_outputs": [] }, @@ -1575,8 +1703,8 @@ } ], "position": { - "left": 1624.7832000000903, - "top": 317.99999999999994 + "left": 1410.000136908115, + "top": 171 }, "post_job_actions": { "RenameDatasetActionout_file1": { @@ -1591,221 +1719,211 @@ "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "1.1.1", "type": "tool", - "uuid": "f9b2dbd6-c547-4c2e-be60-1423e06710a4", + "uuid": "852f2d23-b48e-44d0-aaf2-aed33532d98a", "when": null, "workflow_outputs": [ { - "label": "stranded coverage", + "label": "Uniquely Mapped Stranded Coverage", "output_name": "out_file1", - "uuid": "b747244f-fc40-4f20-b713-882715921a5b" + "uuid": "0a31ff80-b3d1-4959-869f-1a6a3c627dde" } ] } }, "tags": [], - "uuid": "f97bb6df-6f4c-4ccd-8108-6b2d88f35ff4" + "uuid": "f5bde9df-1387-4d76-a90c-1043c93e8de5" }, "tool_id": null, "type": "subworkflow", - "uuid": "3dbdc02e-6875-495d-841a-aae50c3b5f96", + "uuid": "bf990b24-1ec8-4e67-acec-fecf26a3d49f", "when": null, "workflow_outputs": [ { - "label": "stranded coverage", - "output_name": "stranded coverage", - "uuid": "7302e44f-8cce-466e-9672-3b510b55072b" + "label": "Stranded Coverage", + "output_name": "Uniquely Mapped Stranded Coverage", + "uuid": "9161f772-6904-4479-aff4-566295f5b3b2" } ] }, - "17": { + "19": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.3", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/featurecounts/featurecounts/2.0.3+galaxy2", "errors": null, - "id": 17, + "id": 19, "input_connections": { - "advanced_settings|library_type": { - "id": 11, - "output_name": "output_param_text" + "alignment": { + "id": 16, + "output_name": "mapped_reads" }, - "advanced_settings|mask_file": { - "id": 6, + "anno|reference_gene_sets": { + "id": 4, "output_name": "output" }, - "bias_correction|seq_source|index": { - "id": 9, - "output_name": "out1" - }, - "input": { + "strand_specificity": { "id": 13, - "output_name": "mapped_reads" - }, - "reference_annotation|reference_annotation_file": { - "id": 3, - "output_name": "output" + "output_name": "output_param_text" }, "when": { - "id": 5, + "id": 6, "output_name": "output" } }, "inputs": [ { - "description": "runtime parameter for tool Cufflinks", - "name": "advanced_settings" - }, - { - "description": "runtime parameter for tool Cufflinks", - "name": "advanced_settings" - }, - { - "description": "runtime parameter for tool Cufflinks", - "name": "reference_annotation" + "description": "runtime parameter for tool featureCounts", + "name": "anno" } ], - "label": "Compute FPKM with cufflinks", - "name": "Cufflinks", + "label": null, + "name": "featureCounts", "outputs": [ { - "name": "genes_expression", + "name": "output_short", "type": "tabular" }, { - "name": "transcripts_expression", + "name": "output_summary", "type": "tabular" - }, - { - "name": "assembled_isoforms", - "type": "gtf" - }, - { - "name": "total_map_mass", - "type": "txt" - }, - { - "name": "skipped", - "type": "gtf" } ], "position": { - "left": 1266.433349609375, - "top": 1002.5131353932526 + "left": 1713.913195680125, + "top": 672.9994811085061 }, "post_job_actions": { - "HideDatasetActionassembled_isoforms": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "assembled_isoforms" - }, - "HideDatasetActionskipped": { + "HideDatasetActionoutput_short": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "skipped" + "output_name": "output_short" }, - "HideDatasetActiontotal_map_mass": { + "HideDatasetActionoutput_summary": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "total_map_mass" + "output_name": "output_summary" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.3", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/featurecounts/featurecounts/2.0.3+galaxy2", "tool_shed_repository": { - "changeset_revision": "d080005cffe1", - "name": "cufflinks", - "owner": "devteam", + "changeset_revision": "f9d49f5cb597", + "name": "featurecounts", + "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"advanced_settings\": {\"use_advanced_settings\": \"Yes\", \"__current_case__\": 1, \"library_type\": {\"__class__\": \"ConnectedValue\"}, \"mask_file\": {\"__class__\": \"ConnectedValue\"}, \"inner_mean_dist\": \"200\", \"inner_dist_std_dev\": \"80\", \"max_mle_iterations\": \"5000\", \"junc_alpha\": \"0.001\", \"small_anchor_fraction\": \"0.09\", \"overhang_tolerance\": \"8\", \"max_bundle_length\": \"10000000\", \"max_bundle_frags\": \"1000000\", \"min_intron_length\": \"50\", \"trim_three_avgcov_thresh\": \"10\", \"trim_three_dropoff_frac\": \"0.1\"}, \"bias_correction\": {\"do_bias_correction\": \"Yes\", \"__current_case__\": 0, \"seq_source\": {\"index_source\": \"cached\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}}, \"global_model\": null, \"input\": {\"__class__\": \"ConnectedValue\"}, \"length_correction\": \"--no-effective-length-correction\", \"max_intron_len\": \"300000\", \"min_isoform_fraction\": \"0.1\", \"multiread_correct\": true, \"pre_mrna_fraction\": \"0.15\", \"reference_annotation\": {\"use_ref\": \"Use reference annotation\", \"__current_case__\": 1, \"reference_annotation_file\": {\"__class__\": \"ConnectedValue\"}, \"compatible_hits_norm\": \"\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.2.1.3", + "tool_state": "{\"alignment\": {\"__class__\": \"ConnectedValue\"}, \"anno\": {\"anno_select\": \"history\", \"__current_case__\": 2, \"reference_gene_sets\": {\"__class__\": \"ConnectedValue\"}, \"gff_feature_type\": \"exon\", \"gff_feature_attribute\": \"gene_id\", \"summarization_level\": false}, \"extended_parameters\": {\"multifeatures\": {\"multifeat\": \"\", \"__current_case__\": 0}, \"exon_exon_junction_read_counting_enabled\": {\"count_exon_exon_junction_reads\": \"\", \"__current_case__\": 1}, \"long_reads\": false, \"by_read_group\": false, \"largest_overlap\": false, \"min_overlap\": \"1\", \"frac_overlap\": \"0\", \"frac_overlap_feature\": \"0\", \"read_extension_5p\": \"0\", \"read_extension_3p\": \"0\", \"read_reduction\": \"\", \"R\": false}, \"format\": \"tabdel_short\", \"include_feature_length_file\": false, \"pe_parameters\": {\"paired_end_status\": \"single_end\", \"__current_case__\": 0}, \"read_filtering_parameters\": {\"mapping_quality\": \"0\", \"splitonly\": \"\", \"primary\": false, \"ignore_dup\": false}, \"strand_specificity\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0.3+galaxy2", "type": "tool", - "uuid": "351d3b94-214e-496d-8eae-ef61174b6809", + "uuid": "5a03b546-eb3f-4e99-b845-24c8f54ed183", "when": "$(inputs.when)", - "workflow_outputs": [ - { - "label": "genes_expression_cufflinks", - "output_name": "genes_expression", - "uuid": "3ca1813f-0dcd-48b3-9075-15fa3b4a2ef3" - }, - { - "label": "transcripts_expression_cufflinks", - "output_name": "transcripts_expression", - "uuid": "37c571b6-cd9a-42a2-ae3e-d167daf8ef47" - } - ] + "workflow_outputs": [] }, - "18": { + "20": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/stringtie/stringtie/2.2.3+galaxy0", "errors": null, - "id": 18, + "id": 20, "input_connections": { - "code": { - "id": 10, + "guide|guide_source|ref_hist": { + "id": 4, + "output_name": "output" + }, + "input_options|input_bam": { + "id": 16, + "output_name": "mapped_reads" + }, + "rna_strandness": { + "id": 15, "output_name": "output_param_text" }, - "infile": { - "id": 13, - "output_name": "reads_per_gene" + "when": { + "id": 9, + "output_name": "output" } }, - "inputs": [], - "label": "Extract gene counts", - "name": "Text reformatting", - "outputs": [ + "inputs": [ { - "name": "outfile", - "type": "input" + "description": "runtime parameter for tool StringTie", + "name": "adv" + }, + { + "description": "runtime parameter for tool StringTie", + "name": "input_options" } ], - "position": { - "left": 1438.3449044140093, - "top": 809.4166412353516 - }, - "post_job_actions": { - "RenameDatasetActionoutfile": { - "action_arguments": { - "newname": "HTS count like output" - }, + "label": "Compute FPKM with StringTie", + "name": "StringTie", + "outputs": [ + { + "name": "output_gtf", + "type": "gtf" + }, + { + "name": "gene_abundance_estimation", + "type": "tabular" + } + ], + "position": { + "left": 1731.7359886400766, + "top": 1424.2142641508385 + }, + "post_job_actions": { + "HideDatasetActionoutput_gtf": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_gtf" + }, + "RenameDatasetActiongene_abundance_estimation": { + "action_arguments": { + "newname": "Gene abundance estimates from StringTie" + }, "action_type": "RenameDatasetAction", - "output_name": "outfile" + "output_name": "gene_abundance_estimation" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/stringtie/stringtie/2.2.3+galaxy0", "tool_shed_repository": { - "changeset_revision": "86755160afbf", - "name": "text_processing", - "owner": "bgruening", + "changeset_revision": "cbf488da3b2c", + "name": "stringtie", + "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"code\": {\"__class__\": \"ConnectedValue\"}, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "9.3+galaxy1", + "tool_state": "{\"adv\": {\"abundance_estimation\": true, \"omit_sequences\": \"\", \"name_prefix\": null, \"fraction\": \"0.01\", \"min_tlen\": \"200\", \"min_anchor_len\": \"10\", \"min_anchor_cov\": \"1\", \"min_bundle_cov\": \"1\", \"bdist\": \"50\", \"bundle_fraction\": \"1.0\", \"disable_trimming\": false, \"multi_mapping\": false, \"point_features\": {\"__class__\": \"RuntimeValue\"}}, \"guide\": {\"use_guide\": \"yes\", \"__current_case__\": 1, \"guide_source\": {\"guide_gff_select\": \"history\", \"__current_case__\": 1, \"ref_hist\": {\"__class__\": \"ConnectedValue\"}}, \"input_estimation\": true, \"special_outputs\": {\"special_outputs_select\": \"no\", \"__current_case__\": 2}, \"coverage_file\": false}, \"input_options\": {\"input_mode\": \"short_reads\", \"__current_case__\": 0, \"input_bam\": {\"__class__\": \"ConnectedValue\"}}, \"rna_strandness\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.2.3+galaxy0", "type": "tool", - "uuid": "bae7a5b1-a9a1-4d45-9e8b-e375bfc27942", - "when": null, + "uuid": "5a796064-9c52-4b5c-b5da-02c43f6c742f", + "when": "$(inputs.when)", "workflow_outputs": [ { - "label": "HTS count like output", - "output_name": "outfile", - "uuid": "87baa6e9-1455-4537-bf0b-42d4beeba4c0" + "label": "Gene Abundance Estimates from StringTie", + "output_name": "gene_abundance_estimation", + "uuid": "9bcb277a-bb4d-4629-8c71-4cac7cee4c63" } ] }, - "19": { + "21": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/stringtie/stringtie/2.2.3+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.4", "errors": null, - "id": 19, + "id": 21, "input_connections": { - "guide|guide_source|ref_hist": { - "id": 3, + "advanced_settings|library_type": { + "id": 14, + "output_name": "output_param_text" + }, + "advanced_settings|mask_file": { + "id": 8, "output_name": "output" }, - "input_options|input_bam": { - "id": 13, + "bias_correction|seq_source|index": { + "id": 12, + "output_name": "out1" + }, + "input": { + "id": 16, "output_name": "mapped_reads" }, - "rna_strandness": { - "id": 12, - "output_name": "output_param_text" + "reference_annotation|reference_annotation_file": { + "id": 4, + "output_name": "output" }, "when": { "id": 7, @@ -1814,61 +1932,1429 @@ }, "inputs": [ { - "description": "runtime parameter for tool StringTie", - "name": "adv" + "description": "runtime parameter for tool Cufflinks", + "name": "advanced_settings" }, { - "description": "runtime parameter for tool StringTie", - "name": "input_options" + "description": "runtime parameter for tool Cufflinks", + "name": "advanced_settings" + }, + { + "description": "runtime parameter for tool Cufflinks", + "name": "reference_annotation" } ], - "label": "Compute FPKM with StringTie", - "name": "StringTie", + "label": "Compute FPKM with cufflinks", + "name": "Cufflinks", "outputs": [ { - "name": "output_gtf", - "type": "gtf" + "name": "genes_expression", + "type": "tabular" }, { - "name": "gene_abundance_estimation", + "name": "transcripts_expression", "type": "tabular" + }, + { + "name": "assembled_isoforms", + "type": "gtf" + }, + { + "name": "total_map_mass", + "type": "txt" + }, + { + "name": "skipped", + "type": "gtf" } ], "position": { - "left": 1224.9188687452759, - "top": 1561.7042971930236 + "left": 1998.2812719123385, + "top": 1150.343757982693 }, "post_job_actions": { - "HideDatasetActionoutput_gtf": { + "HideDatasetActionassembled_isoforms": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "output_gtf" + "output_name": "assembled_isoforms" + }, + "HideDatasetActionskipped": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "skipped" + }, + "HideDatasetActiontotal_map_mass": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "total_map_mass" + }, + "RenameDatasetActiongenes_expression": { + "action_arguments": { + "newname": "Genes Expression from Cufflinks" + }, + "action_type": "RenameDatasetAction", + "output_name": "genes_expression" + }, + "RenameDatasetActiontranscripts_expression": { + "action_arguments": { + "newname": "Transcripts Expression from Cufflinks" + }, + "action_type": "RenameDatasetAction", + "output_name": "transcripts_expression" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/stringtie/stringtie/2.2.3+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.4", "tool_shed_repository": { - "changeset_revision": "cbf488da3b2c", - "name": "stringtie", - "owner": "iuc", + "changeset_revision": "6926716bbfb5", + "name": "cufflinks", + "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"adv\": {\"abundance_estimation\": true, \"omit_sequences\": \"\", \"name_prefix\": null, \"fraction\": \"0.01\", \"min_tlen\": \"200\", \"min_anchor_len\": \"10\", \"min_anchor_cov\": \"1\", \"min_bundle_cov\": \"1\", \"bdist\": \"50\", \"bundle_fraction\": \"1.0\", \"disable_trimming\": false, \"multi_mapping\": false, \"point_features\": {\"__class__\": \"RuntimeValue\"}}, \"guide\": {\"use_guide\": \"yes\", \"__current_case__\": 1, \"guide_source\": {\"guide_gff_select\": \"history\", \"__current_case__\": 1, \"ref_hist\": {\"__class__\": \"ConnectedValue\"}}, \"input_estimation\": true, \"special_outputs\": {\"special_outputs_select\": \"no\", \"__current_case__\": 2}, \"coverage_file\": false}, \"input_options\": {\"input_mode\": \"short_reads\", \"__current_case__\": 0, \"input_bam\": {\"__class__\": \"ConnectedValue\"}}, \"rna_strandness\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.2.3+galaxy0", + "tool_state": "{\"advanced_settings\": {\"use_advanced_settings\": \"Yes\", \"__current_case__\": 1, \"library_type\": {\"__class__\": \"ConnectedValue\"}, \"mask_file\": {\"__class__\": \"ConnectedValue\"}, \"inner_mean_dist\": \"200\", \"inner_dist_std_dev\": \"80\", \"max_mle_iterations\": \"5000\", \"junc_alpha\": \"0.001\", \"small_anchor_fraction\": \"0.09\", \"overhang_tolerance\": \"8\", \"max_bundle_length\": \"10000000\", \"max_bundle_frags\": \"1000000\", \"min_intron_length\": \"50\", \"trim_three_avgcov_thresh\": \"10\", \"trim_three_dropoff_frac\": \"0.1\"}, \"bias_correction\": {\"do_bias_correction\": \"Yes\", \"__current_case__\": 0, \"seq_source\": {\"index_source\": \"cached\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}}, \"global_model\": null, \"input\": {\"__class__\": \"ConnectedValue\"}, \"length_correction\": \"--no-effective-length-correction\", \"max_intron_len\": \"300000\", \"min_isoform_fraction\": \"0.1\", \"multiread_correct\": true, \"pre_mrna_fraction\": \"0.15\", \"reference_annotation\": {\"use_ref\": \"Use reference annotation\", \"__current_case__\": 1, \"reference_annotation_file\": {\"__class__\": \"ConnectedValue\"}, \"compatible_hits_norm\": \"\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.2.1.4", "type": "tool", - "uuid": "d87ca6aa-3738-49a3-8090-41aa896b52fa", + "uuid": "af5419b7-ae6b-498c-8123-f609b8fcd8b4", "when": "$(inputs.when)", "workflow_outputs": [ { - "label": "genes_expression_stringtie", - "output_name": "gene_abundance_estimation", - "uuid": "07d67129-87be-4281-b82b-64fcb300b0e1" + "label": "Transcripts Expression from Cufflinks", + "output_name": "transcripts_expression", + "uuid": "2c13ef79-948c-4f5f-8516-a769550128fd" + }, + { + "label": "Genes Expression from Cufflinks", + "output_name": "genes_expression", + "uuid": "3bd4fbda-f241-4ebd-b7a5-dea7271c521e" + } + ] + }, + "22": { + "annotation": "", + "id": 22, + "input_connections": { + "RNA STAR count tables": { + "id": 16, + "input_subworkflow_step_id": 3, + "output_name": "reads_per_gene" + }, + "Strandness param": { + "id": 5, + "input_subworkflow_step_id": 2, + "output_name": "output" + }, + "featureCounts count table": { + "id": 19, + "input_subworkflow_step_id": 4, + "output_name": "output_short" + }, + "featureCounts summaries collection": { + "id": 19, + "input_subworkflow_step_id": 1, + "output_name": "output_summary" + } + }, + "inputs": [], + "label": null, + "name": "Process Count files", + "outputs": [], + "position": { + "left": 2161.105895746449, + "top": 665.1799212422835 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0002-1964-4960", + "name": "Lucille Delisle" + }, + { + "class": "Person", + "identifier": "https://orcid.org/0000-0002-5192-126X", + "name": "Pavankumar Videm" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "Process Count files", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "This file will be used in MultiQC if the user opts out of featureCounts to generate count files. ", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_text_file_with_recurring_lines/9.3+galaxy1", + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [], + "label": "A dummy featureCounts summary file", + "name": "Create text file", + "outputs": [ + { + "name": "outfile", + "type": "txt" + } + ], + "position": { + "left": 0, + "top": 16 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_text_file_with_recurring_lines/9.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "86755160afbf", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"token_set\": [{\"__index__\": 0, \"line\": \"Status\\tFeaturecounts_was_not_used\", \"repeat_select\": {\"repeat_select_opts\": \"user\", \"__current_case__\": 0, \"times\": \"1\"}}, {\"__index__\": 1, \"line\": \"Assigned\\t0\", \"repeat_select\": {\"repeat_select_opts\": \"user\", \"__current_case__\": 0, \"times\": \"1\"}}, {\"__index__\": 2, \"line\": \"Unassigned_Unmapped\\t0\", \"repeat_select\": {\"repeat_select_opts\": \"user\", \"__current_case__\": 0, \"times\": \"1\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "9.3+galaxy1", + "type": "tool", + "uuid": "be0268be-a3ec-4d75-854b-d8eecf4b4521", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "Collection from featureCounts summaries", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "Collection from featureCounts summaries", + "name": "featureCounts summaries collection" + } + ], + "label": "featureCounts summaries collection", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 2.3481338306177992, + "top": 215.26828327443155 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"tag\": null, \"collection_type\": \"list\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "9ca62bd8-0272-41e2-9e4b-e8f45c4e0c19", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence", + "name": "Strandness param" + } + ], + "label": "Strandness param", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 1.7190473798223138e-05, + "top": 433.85391433745605 + }, + "tool_id": null, + "tool_state": "{\"restrictions\": [\"stranded - forward\", \"stranded - reverse\", \"unstranded\"], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "180fc8bd-b8f4-486b-b300-e503bf379373", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "d0e53d5e-1b5f-40d7-80e6-f15c5e2ffbc8" + } + ] + }, + "3": { + "annotation": "Count tables collection from RNA STAR", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "Count tables collection from RNA STAR", + "name": "RNA STAR count tables" + } + ], + "label": "RNA STAR count tables", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 5.368903743075304, + "top": 589.5341644488473 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "d94c5c03-7bad-493f-9f5d-c5b6f33157ae", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "Count tables collection from featureCounts", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "Count tables collection from featureCounts", + "name": "featureCounts count table" + } + ], + "label": "featureCounts count table", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 7.4993932207943, + "top": 704.0194730841151 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"tag\": null, \"collection_type\": \"list\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "12f710b8-757e-4c25-90be-4cfca673f54b", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/9.3+galaxy1", + "errors": null, + "id": 5, + "input_connections": { + "infile": { + "id": 0, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Text transformation", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 279.9999490094584, + "top": 0 + }, + "post_job_actions": { + "ChangeDatatypeActionoutput": { + "action_arguments": { + "newtype": "tabular" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "output" + }, + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/9.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "86755160afbf", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv_opts\": {\"adv_opts_selector\": \"basic\", \"__current_case__\": 0}, \"code\": \"s/__tc__/\\\\t/g\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "9.3+galaxy1", + "type": "tool", + "uuid": "3588c02b-15b7-487b-8970-bc76ddf8348a", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "awk command from strand for STAR counts", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_text", + "type": "expression.json" + } + ], + "position": { + "left": 279.9999833196541, + "top": 401.33828843669767 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_text": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_text" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"stranded - forward\", \"to\": \"NR>4{print $1\\\"\\\\t\\\"$3}\"}, {\"__index__\": 1, \"from\": \"stranded - reverse\", \"to\": \"NR>4{print $1\\\"\\\\t\\\"$4}\"}, {\"__index__\": 2, \"from\": \"unstranded\", \"to\": \"NR>4{print $1\\\"\\\\t\\\"$2}\"}]}, \"output_param_type\": \"text\", \"unmapped\": {\"on_unmapped\": \"fail\", \"__current_case__\": 1}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.2.0", + "type": "tool", + "uuid": "2b9a5ca1-e974-450b-99b3-3fcce531154b", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "featureCounts summaries", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 1, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [], + "label": "featureCounts summaries", + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 840.0000391186242, + "top": 16 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "FeatureCounts Summary Table" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.2.0", + "type": "tool", + "uuid": "26eca035-e403-4392-9ba9-08cd471154dd", + "when": null, + "workflow_outputs": [ + { + "label": "FeatureCounts Summary Table", + "output_name": "data_param", + "uuid": "8c15f8aa-f2eb-41bf-bbaa-947263f3bfec" + } + ] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1", + "errors": null, + "id": 8, + "input_connections": { + "code": { + "id": 6, + "output_name": "output_param_text" + }, + "infile": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": "Extract gene counts", + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 560.0000901091657, + "top": 386.17188642026633 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + }, + "RenameDatasetActionoutfile": { + "action_arguments": { + "newname": "HTS count like output" + }, + "action_type": "RenameDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "86755160afbf", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": {\"__class__\": \"ConnectedValue\"}, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "9.3+galaxy1", + "type": "tool", + "uuid": "34922bd3-4676-4f7d-8e05-af0ef0c1efa4", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "Counts Table ", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 9, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 4, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 8, + "output_name": "outfile" + } + }, + "inputs": [], + "label": "Counts table", + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 837.0001537846339, + "top": 413.1722363660909 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Counts Table" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.2.0", + "type": "tool", + "uuid": "d87cdd15-8b7c-4498-a818-7369ee4e006a", + "when": null, + "workflow_outputs": [ + { + "label": "Counts Table", + "output_name": "data_param", + "uuid": "bb7b60bf-81b1-4d58-9724-9814e9284ab3" + } + ] + } + }, + "tags": [], + "uuid": "1d5779a5-fb3a-453a-9fec-8acd491ce5ab" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "6957fcb0-4312-4764-9d80-c5306759f914", + "when": null, + "workflow_outputs": [ + { + "label": "Counts Table", + "output_name": "Counts Table", + "uuid": "dfe40af6-1361-4953-aac7-fbca6cfdb47a" + } + ] + }, + "23": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", + "errors": null, + "id": 23, + "input_connections": { + "results_0|software_cond|input": { + "id": 10, + "output_name": "report_json" + }, + "results_1|software_cond|output_0|type|input": { + "id": 16, + "output_name": "output_log" + }, + "results_1|software_cond|output_1|type|input": { + "id": 16, + "output_name": "reads_per_gene" + }, + "results_2|software_cond|input": { + "id": 22, + "output_name": "FeatureCounts Summary Table" + }, + "when": { + "id": 11, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": "Combined MultiQC without additional QC", + "name": "MultiQC", + "outputs": [ + { + "name": "html_report", + "type": "html" + }, + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 2423.9455325643053, + "top": 32.99591513431855 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "f7e2f1eb3a16", + "name": "multiqc", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"fastp\", \"__current_case__\": 7, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"star\", \"__current_case__\": 28, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"log\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"type\": {\"type\": \"genecounts\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"featureCounts\", \"__current_case__\": 9, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.24.1+galaxy0", + "type": "tool", + "uuid": "e5335a24-fec9-422c-b93c-c172ad7e1b8c", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "Small MultiQC stats", + "output_name": "stats", + "uuid": "f9eecf9b-d360-4d97-962f-24efc44d5b99" + }, + { + "label": "Small MultiQC HTML report", + "output_name": "html_report", + "uuid": "24cf626f-6539-4123-85d6-214b88e2c4b7" + } + ] + }, + "24": { + "annotation": "", + "id": 24, + "input_connections": { + "FASTQ collection": { + "id": 0, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "STAR BAM": { + "id": 16, + "input_subworkflow_step_id": 6, + "output_name": "mapped_reads" + }, + "STAR counts": { + "id": 16, + "input_subworkflow_step_id": 3, + "output_name": "reads_per_gene" + }, + "STAR logs": { + "id": 16, + "input_subworkflow_step_id": 2, + "output_name": "output_log" + }, + "fastp Reports": { + "id": 10, + "input_subworkflow_step_id": 1, + "output_name": "report_json" + }, + "featureCounts summaries": { + "id": 22, + "input_subworkflow_step_id": 4, + "output_name": "FeatureCounts Summary Table" + }, + "reference_annotation_gtf": { + "id": 4, + "input_subworkflow_step_id": 5, + "output_name": "output" + }, + "when": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "", + "name": "Combined MultiQC Quality Report" + } + ], + "label": "Combined MultiQC Quality Report", + "name": "RNA-seq-QC", + "outputs": [], + "position": { + "left": 2465.503860179348, + "top": 451.63585583919314 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0002-5192-126X", + "name": "Pavankumar Videm" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "RNA-seq-QC", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "RNA-seq paired FASTQ collection", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "RNA-seq paired FASTQ collection", + "name": "FASTQ collection" + } + ], + "label": "FASTQ collection", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 13.596214101155162 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "1bb12b7e-2ee1-4d8a-80d6-4259bea1efae", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "fastp Reports", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "fastp Reports", + "name": "fastp Reports" + } + ], + "label": "fastp Reports", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 61.11669921875, + "top": 134.59621410115517 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "43c69a53-b1dc-4089-9801-18e980088a2e", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "STAR log files", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "STAR log files", + "name": "STAR logs" + } + ], + "label": "STAR logs", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 103.183349609375, + "top": 232.67952708943642 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "5ae91949-4ffe-4aef-81fa-fa3cb4e86f5a", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "STAR counts" + } + ], + "label": "STAR counts", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 135, + "top": 311.09621410115517 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "57b8e456-2987-42aa-8ee3-3d25a0d5fecf", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "featureCounts Summaries file", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "featureCounts Summaries file", + "name": "featureCounts summaries" + } + ], + "label": "featureCounts summaries", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 168.6500244140625, + "top": 397.7962263081864 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "5a5cb076-92cb-48bd-80e0-d7bfa19fe969", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "Reference annotation", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "Reference annotation", + "name": "reference_annotation_gtf" + } + ], + "label": "reference_annotation_gtf", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 236.05178147043327, + "top": 521.1329885056177 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "9657bd5f-5510-412b-9128-0bb903e2f572", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "Mapped BAM files from STAR", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ + { + "description": "Mapped BAM files from STAR", + "name": "STAR BAM" + } + ], + "label": "STAR BAM", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 287.0148354755526, + "top": 645.9144573009889 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "b3a7345d-49fa-4b34-bd56-565f250f6d97", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "errors": null, + "id": 7, + "input_connections": { + "input_file": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool FastQC", + "name": "adapters" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "contaminants" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "limits" + } + ], + "label": "FastQC check read qualities", + "name": "FastQC", + "outputs": [ + { + "name": "html_file", + "type": "html" + }, + { + "name": "text_file", + "type": "txt" + } + ], + "position": { + "left": 709.0902620065212, + "top": 0.0 + }, + "post_job_actions": { + "HideDatasetActionhtml_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "html_file" + }, + "HideDatasetActiontext_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_file" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "tool_shed_repository": { + "changeset_revision": "2c64fded1286", + "name": "fastqc", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapters\": {\"__class__\": \"RuntimeValue\"}, \"contaminants\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"kmers\": \"7\", \"limits\": {\"__class__\": \"RuntimeValue\"}, \"min_length\": null, \"nogroup\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.74+galaxy1", + "type": "tool", + "uuid": "d4f16966-836e-49cd-8987-18b6e68205b8", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/gtftobed12/gtftobed12/357", + "errors": null, + "id": 8, + "input_connections": { + "gtf_file": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [], + "label": "convert gtf to bed12", + "name": "Convert GTF to BED12", + "outputs": [ + { + "name": "bed_file", + "type": "bed12" + } + ], + "position": { + "left": 650.1095703232029, + "top": 767.5962172140157 + }, + "post_job_actions": { + "HideDatasetActionbed_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bed_file" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/gtftobed12/gtftobed12/357", + "tool_shed_repository": { + "changeset_revision": "b026dae67fba", + "name": "gtftobed12", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advanced_options\": {\"advanced_options_selector\": \"default\", \"__current_case__\": 0}, \"gtf_file\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "357", + "type": "tool", + "uuid": "ed8685b7-7904-4f28-8ea9-2faffb05bacf", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", + "errors": null, + "id": 9, + "input_connections": { + "input": { + "id": 6, + "output_name": "output" + } + }, + "inputs": [], + "label": "Subsample 200k reads", + "name": "Samtools view", + "outputs": [ + { + "name": "outputsam", + "type": "input" + } + ], + "position": { + "left": 650.1093443590796, + "top": 919.946789222449 + }, + "post_job_actions": { + "HideDatasetActionoutputsam": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outputsam" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", + "tool_shed_repository": { + "changeset_revision": "32dc5f781059", + "name": "samtools_view", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"selected_reads\", \"__current_case__\": 1, \"filter_config\": {\"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cond_rg\": {\"select_rg\": \"no\", \"__current_case__\": 0}, \"cond_expr\": {\"select_expr\": \"no\", \"__current_case__\": 0}, \"quality\": null, \"library\": \"\", \"cigarcons\": null, \"inclusive_filter\": null, \"exclusive_filter\": null, \"exclusive_filter_all\": null, \"tag\": \"\", \"qname_file\": {\"__class__\": \"RuntimeValue\"}}, \"subsample_config\": {\"subsampling_mode\": {\"select_subsample\": \"target\", \"__current_case__\": 1, \"target\": \"200000\", \"seed\": \"1\"}}, \"output_options\": {\"reads_report_type\": \"retained\", \"__current_case__\": 0, \"complementary_output\": false, \"adv_output\": {\"readtags\": [], \"collapsecigar\": false}, \"output_format\": {\"oformat\": \"bam\", \"__current_case__\": 2}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.20+galaxy3", + "type": "tool", + "uuid": "fa918b19-c767-43dd-afb6-fcdb3cd20fa7", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_idxstats/samtools_idxstats/2.0.5", + "errors": null, + "id": 10, + "input_connections": { + "input": { + "id": 6, + "output_name": "output" + } + }, + "inputs": [], + "label": "Get reads number per chromosome", + "name": "Samtools idxstats", + "outputs": [ + { + "name": "output", + "type": "tabular" + } + ], + "position": { + "left": 650.1095878752642, + "top": 1126.5962172140155 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_idxstats/samtools_idxstats/2.0.5", + "tool_shed_repository": { + "changeset_revision": "fa5d3e61e429", + "name": "samtools_idxstats", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0.5", + "type": "tool", + "uuid": "0c0789f8-21d9-4fdc-80c6-488aded24611", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", + "errors": null, + "id": 11, + "input_connections": { + "inputFile": { + "id": 6, + "output_name": "output" + } + }, + "inputs": [], + "label": "Remove duplicates", + "name": "MarkDuplicates", + "outputs": [ + { + "name": "metrics_file", + "type": "txt" + }, + { + "name": "outFile", + "type": "bam" + } + ], + "position": { + "left": 648.4598772618594, + "top": 1276.9345984373845 + }, + "post_job_actions": { + "HideDatasetActionmetrics_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "metrics_file" + }, + "HideDatasetActionoutFile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outFile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", + "tool_shed_repository": { + "changeset_revision": "3f254c5ced1d", + "name": "picard", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"assume_sorted\": true, \"barcode_tag\": \"\", \"comments\": [], \"duplicate_scoring_strategy\": \"SUM_OF_BASE_QUALITIES\", \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"optical_duplicate_pixel_distance\": \"100\", \"read_name_regex\": \"\", \"remove_duplicates\": false, \"validation_stringency\": \"LENIENT\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.1.1.0", + "type": "tool", + "uuid": "c8d04f50-da21-4f5b-9d64-2dc652b71d77", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/nilesh/rseqc/rseqc_read_distribution/5.0.3+galaxy0", + "errors": null, + "id": 12, + "input_connections": { + "input": { + "id": 6, + "output_name": "output" + }, + "refgene": { + "id": 8, + "output_name": "bed_file" + } + }, + "inputs": [], + "label": "Read distribution over genomic features", + "name": "Read Distribution", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 920.1095706393493, + "top": 658.5962172140157 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/nilesh/rseqc/rseqc_read_distribution/5.0.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "27e16a30667a", + "name": "rseqc", + "owner": "nilesh", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"refgene\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "5.0.3+galaxy0", + "type": "tool", + "uuid": "4ecf1a7a-8648-4224-9c04-ab5d33614d63", + "when": null, + "workflow_outputs": [] + }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/nilesh/rseqc/rseqc_geneBody_coverage/5.0.3+galaxy0", + "errors": null, + "id": 13, + "input_connections": { + "batch_mode|input": { + "id": 9, + "output_name": "outputsam" + }, + "refgene": { + "id": 8, + "output_name": "bed_file" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Gene Body Coverage (BAM)", + "name": "batch_mode" + } + ], + "label": "Get gene body coverage", + "name": "Gene Body Coverage (BAM)", + "outputs": [ + { + "name": "outputcurvespdf", + "type": "pdf" + }, + { + "name": "outputtxt", + "type": "txt" + } + ], + "position": { + "left": 919.109375, + "top": 868.5962141011552 + }, + "post_job_actions": { + "HideDatasetActionoutputcurvespdf": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outputcurvespdf" + }, + "HideDatasetActionoutputtxt": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outputtxt" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/nilesh/rseqc/rseqc_geneBody_coverage/5.0.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "27e16a30667a", + "name": "rseqc", + "owner": "nilesh", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"batch_mode\": {\"batch_mode_selector\": \"batch\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}, \"minimum_length\": \"100\", \"refgene\": {\"__class__\": \"ConnectedValue\"}, \"rscript_output\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "5.0.3+galaxy0", + "type": "tool", + "uuid": "c996512e-789b-422c-833c-de854e30674f", + "when": null, + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", + "errors": null, + "id": 14, + "input_connections": { + "results_0|software_cond|output_0|input": { + "id": 7, + "output_name": "text_file" + }, + "results_1|software_cond|input": { + "id": 1, + "output_name": "output" + }, + "results_2|software_cond|output_0|type|input": { + "id": 2, + "output_name": "output" + }, + "results_2|software_cond|output_1|type|input": { + "id": 3, + "output_name": "output" + }, + "results_3|software_cond|input": { + "id": 4, + "output_name": "output" + }, + "results_4|software_cond|output_0|type|input": { + "id": 12, + "output_name": "output" + }, + "results_4|software_cond|output_1|type|input": { + "id": 13, + "output_name": "outputtxt" + }, + "results_5|software_cond|output_0|type|input": { + "id": 10, + "output_name": "output" + }, + "results_6|software_cond|output_0|input": { + "id": 11, + "output_name": "metrics_file" + } + }, + "inputs": [], + "label": "Combined Quality Report", + "name": "MultiQC", + "outputs": [ + { + "name": "html_report", + "type": "html" + }, + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 1240.1096398991554, + "top": 428.5962172140157 + }, + "post_job_actions": { + "RenameDatasetActionhtml_report": { + "action_arguments": { + "newname": "MultiQC HTML report" + }, + "action_type": "RenameDatasetAction", + "output_name": "html_report" + }, + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "MultiQC Stats table" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "f7e2f1eb3a16", + "name": "multiqc", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"fastqc\", \"__current_case__\": 8, \"output\": [{\"__index__\": 0, \"type\": \"data\", \"input\": {\"__class__\": \"RuntimeValue\"}}]}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"fastp\", \"__current_case__\": 7, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"star\", \"__current_case__\": 28, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"log\", \"__current_case__\": 0, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 1, \"type\": {\"type\": \"genecounts\", \"__current_case__\": 1, \"input\": {\"__class__\": \"RuntimeValue\"}}}]}}, {\"__index__\": 3, \"software_cond\": {\"software\": \"featureCounts\", \"__current_case__\": 9, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 4, \"software_cond\": {\"software\": \"rseqc\", \"__current_case__\": 22, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"read_distribution\", \"__current_case__\": 6, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 1, \"type\": {\"type\": \"gene_body_coverage\", \"__current_case__\": 1, \"input\": {\"__class__\": \"RuntimeValue\"}}}]}}, {\"__index__\": 5, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 24, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"idxstats\", \"__current_case__\": 2, \"input\": {\"__class__\": \"RuntimeValue\"}}}]}}, {\"__index__\": 6, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 17, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"RuntimeValue\"}}]}}], \"title\": \"Combined Quality Report \", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.24.1+galaxy0", + "type": "tool", + "uuid": "b5e9c0d2-62f4-41b2-a1c7-5677d8555fd4", + "when": null, + "workflow_outputs": [ + { + "label": "MultiQC stats", + "output_name": "stats", + "uuid": "cbf99516-9349-4f2a-ad1f-05c732cb5263" + }, + { + "label": "MultiQC HTML report", + "output_name": "html_report", + "uuid": "7306cd4b-1017-4542-bf57-81d2d83d6a97" + } + ] + } + }, + "tags": [], + "uuid": "3db32329-f64a-4233-a795-dde75648b802" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "c0aaa16c-8a9b-4fe1-8c3d-9e77f64da413", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "MultiQC HTML report", + "output_name": "MultiQC HTML report", + "uuid": "717627ed-188d-4cb5-9a03-b1eec15f7922" + }, + { + "label": "MultiQC stats", + "output_name": "MultiQC stats", + "uuid": "43ed1ffc-7df8-42a6-95f7-dc2b2060a910" } ] } }, "tags": [ - "RNAseq" + "RNAseq", + "transcriptomics" ], - "uuid": "6a424c0e-eb24-4f61-8750-adc09f4db1b1", + "uuid": "885ec907-9f61-4a11-9d23-2243389e7335", "version": 1 } \ No newline at end of file