From a114979815e6c45262d1830cc0c7d02aec89462e Mon Sep 17 00:00:00 2001 From: Lucille Delisle Date: Mon, 11 Sep 2023 16:04:45 +0200 Subject: [PATCH] update workflow --- .../transcriptomics/rnaseq-sr/rnaseq-sr.ga | 2191 +++++++---------- 1 file changed, 907 insertions(+), 1284 deletions(-) diff --git a/workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga b/workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga index 2bf8cd853..bd159c3f9 100644 --- a/workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga +++ b/workflows/transcriptomics/rnaseq-sr/rnaseq-sr.ga @@ -1,6 +1,6 @@ { "a_galaxy_workflow": "true", - "annotation": "This workflow takes as input a list of single-read fastqs. Adapters and bad quality bases are removed with cutadapt. Reads are mapped with STAR with ENCODE parameters and genes are counted simultaneously. The counts are reprocess to be similar to HTSeq-count output. FPKM are computed with cufflinks. Coverage (per million mapped reads) are computed with bedtools on uniquely mapped reads.", + "annotation": "This workflow takes as input a list of single-reads fastqs. Adapters and bad quality bases are removed with cutadapt. Reads are mapped with STAR with ENCODE parameters and genes are counted simultaneously as well as normalized coverage (per million mapped reads) on uniquely mapped reads. The counts are reprocessed to be similar to HTSeq-count output. FPKM are computed with cufflinks and/or with StringTie.", "creator": [ { "class": "Person", @@ -30,13 +30,13 @@ "outputs": [], "position": { "left": 0, - "top": 274.77146559574123 + "top": 354 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": \"\", \"collection_type\": \"list\"}", + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", "tool_version": null, "type": "data_collection_input", - "uuid": "688da967-e739-409a-b950-b4e4985a1a3b", + "uuid": "633ddb66-8a2b-4822-b894-2e947bf6607b", "when": null, "workflow_outputs": [] }, @@ -56,8 +56,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 15.45001220703125, - "top": 335.3214839062881 + "left": 42.45001220703125, + "top": 430.91668701171875 }, "tool_id": null, "tool_state": "{\"parameter_type\": \"text\", \"optional\": false}", @@ -83,8 +83,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 32.63336181640625, - "top": 423.53809767581936 + "left": 107.63336181640625, + "top": 522.134886401586 }, "tool_id": null, "tool_state": "{\"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", @@ -110,8 +110,8 @@ "name": "Input dataset", "outputs": [], "position": { - "left": 50.60003662109375, - "top": 508.15479689456936 + "left": 125.60003662109375, + "top": 606.751585620336 }, "tool_id": null, "tool_state": "{\"optional\": false, \"tag\": \"\"}", @@ -137,8 +137,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 81.25, - "top": 568.5214961133194 + "left": 156.25, + "top": 667.118284839086 }, "tool_id": null, "tool_state": "{\"restrictions\": [\"stranded - forward\", \"stranded - reverse\", \"unstranded\"], \"parameter_type\": \"text\", \"optional\": false}", @@ -149,37 +149,10 @@ "workflow_outputs": [] }, "5": { - "annotation": "Whether coverage should be for forward and reverse separated", - "content_id": null, - "errors": null, - "id": 5, - "input_connections": {}, - "inputs": [ - { - "description": "Whether coverage should be for forward and reverse separated", - "name": "split coverage by strand" - } - ], - "label": "split coverage by strand", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 105.10003662109375, - "top": 633.6547968945694 - }, - "tool_id": null, - "tool_state": "{\"parameter_type\": \"boolean\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "890e70f2-9965-4873-9d97-c267b1857098", - "when": null, - "workflow_outputs": [] - }, - "6": { "annotation": "Whether FPKM values should be computed with cufflinks", "content_id": null, "errors": null, - "id": 6, + "id": 5, "input_connections": {}, "inputs": [ { @@ -191,8 +164,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 127.6500244140625, - "top": 718.8881342969131 + "left": 177.6500244140625, + "top": 735.4800895070166 }, "tool_id": null, "tool_state": "{\"parameter_type\": \"boolean\", \"optional\": false}", @@ -202,11 +175,11 @@ "when": null, "workflow_outputs": [] }, - "7": { + "6": { "annotation": "Could be a gtf with for example one entry for the chrM forward and one entry for the chrM reverse", "content_id": null, "errors": null, - "id": 7, + "id": 6, "input_connections": {}, "inputs": [ { @@ -218,8 +191,8 @@ "name": "Input dataset", "outputs": [], "position": { - "left": 154.7333984375, - "top": 780.0047724805069 + "left": 201.73333740234375, + "top": 809.5967887257666 }, "tool_id": null, "tool_state": "{\"optional\": true, \"tag\": \"\"}", @@ -229,11 +202,11 @@ "when": null, "workflow_outputs": [] }, - "8": { + "7": { "annotation": "Whether FPKM values should be computed with StringTie", "content_id": null, "errors": null, - "id": 8, + "id": 7, "input_connections": {}, "inputs": [ { @@ -245,8 +218,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 181.88330078125, - "top": 882.8214228711319 + "left": 245.88330078125, + "top": 926.4134391163916 }, "tool_id": null, "tool_state": "{\"parameter_type\": \"boolean\", \"optional\": false}", @@ -256,11 +229,11 @@ "when": null, "workflow_outputs": [] }, - "9": { + "8": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "errors": null, - "id": 9, + "id": 8, "input_connections": { "library|input_1": { "id": 0, @@ -271,7 +244,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Cutadapt", + "name": "library" + } + ], "label": "Cutadapt (remove adapter + bad quality bases)", "name": "Cutadapt", "outputs": [ @@ -285,8 +263,8 @@ } ], "position": { - "left": 425.61669921875, - "top": 240.53809767581936 + "left": 500.61669921875, + "top": 339.134886401586 }, "post_job_actions": { "HideDatasetActionout1": { @@ -294,6 +272,11 @@ "action_type": "HideDatasetAction", "output_name": "out1" }, + "HideDatasetActionout_pairs": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_pairs" + }, "HideDatasetActionreport": { "action_arguments": {}, "action_type": "HideDatasetAction", @@ -307,18 +290,18 @@ "owner": "lparsons", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": \" \", \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": [], \"cut\": \"0\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": \" \", \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"RuntimeValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": [], \"cut\": \"0\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "4.4+galaxy0", "type": "tool", "uuid": "7f7ca59a-09db-491f-b185-1caa51e9d2aa", "when": null, "workflow_outputs": [] }, - "10": { + "9": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", "errors": null, - "id": 10, + "id": 9, "input_connections": { "components_0|param_type|component_value": { "id": 2, @@ -335,8 +318,8 @@ } ], "position": { - "left": 904.0166015625, - "top": 905.6500244140625 + "left": 979.0166015625, + "top": 1004.2468131398291 }, "post_job_actions": { "HideDatasetActionout1": { @@ -359,11 +342,11 @@ "when": null, "workflow_outputs": [] }, - "11": { + "10": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1", "errors": null, - "id": 11, + "id": 10, "input_connections": { "input_param_type|input_param": { "id": 4, @@ -380,8 +363,8 @@ } ], "position": { - "left": 1121.5, - "top": 715.6666870117188 + "left": 1196.5, + "top": 814.2634757374854 }, "post_job_actions": { "HideDatasetActionoutput_param_text": { @@ -404,11 +387,11 @@ "when": null, "workflow_outputs": [] }, - "12": { + "11": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1", "errors": null, - "id": 12, + "id": 11, "input_connections": { "input_param_type|input_param": { "id": 4, @@ -425,8 +408,8 @@ } ], "position": { - "left": 935.4833984375, - "top": 1081.6289545849618 + "left": 1010.4833984375, + "top": 1180.2257433107284 }, "post_job_actions": { "HideDatasetActionoutput_param_text": { @@ -449,11 +432,11 @@ "when": null, "workflow_outputs": [] }, - "13": { + "12": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1", "errors": null, - "id": 13, + "id": 12, "input_connections": { "input_param_type|input_param": { "id": 4, @@ -470,8 +453,8 @@ } ], "position": { - "left": 924.5675984682158, - "top": 1443.646195649171 + "left": 913.0522727953694, + "top": 1576.8436797276113 }, "post_job_actions": { "HideDatasetActionoutput_param_text": { @@ -494,87 +477,222 @@ "when": null, "workflow_outputs": [] }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.10b+galaxy4", + "errors": null, + "id": 13, + "input_connections": { + "refGenomeSource|GTFconditional|genomeDir": { + "id": 2, + "output_name": "output" + }, + "refGenomeSource|GTFconditional|sjdbGTFfile": { + "id": 3, + "output_name": "output" + }, + "singlePaired|input1": { + "id": 8, + "output_name": "out1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool RNA STAR", + "name": "singlePaired" + } + ], + "label": "STAR: map and count and coverage splitted", + "name": "RNA STAR", + "outputs": [ + { + "name": "output_log", + "type": "txt" + }, + { + "name": "splice_junctions", + "type": "interval" + }, + { + "name": "mapped_reads", + "type": "bam" + }, + { + "name": "reads_per_gene", + "type": "tabular" + }, + { + "name": "signal_unique_str1", + "type": "bedgraph" + }, + { + "name": "signal_uniquemultiple_str1", + "type": "bedgraph" + }, + { + "name": "signal_unique_str2", + "type": "bedgraph" + }, + { + "name": "signal_uniquemultiple_str2", + "type": "bedgraph" + } + ], + "position": { + "left": 819.25, + "top": 335.9166717529297 + }, + "post_job_actions": { + "HideDatasetActionsignal_unique_str1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "signal_unique_str1" + }, + "HideDatasetActionsignal_unique_str2": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "signal_unique_str2" + }, + "HideDatasetActionsignal_uniquemultiple_str1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "signal_uniquemultiple_str1" + }, + "HideDatasetActionsignal_uniquemultiple_str2": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "signal_uniquemultiple_str2" + }, + "HideDatasetActionsplice_junctions": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "splice_junctions" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.10b+galaxy4", + "tool_shed_repository": { + "changeset_revision": "79de45b5069b", + "name": "rgrnastar", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"algo\": {\"params\": {\"settingsType\": \"full\", \"__current_case__\": 3, \"seed\": {\"seedSearchStartLmax\": \"50\", \"seedSearchStartLmaxOverLread\": \"1.0\", \"seedSearchLmax\": \"0\", \"seedMultimapNmax\": \"10000\", \"seedPerReadNmax\": \"1000\", \"seedPerWindowNmax\": \"50\", \"seedNoneLociPerWindow\": \"10\"}, \"align\": {\"alignIntronMin\": \"20\", \"alignIntronMax\": \"1000000\", \"alignMatesGapMax\": \"1000000\", \"alignSJoverhangMin\": \"8\", \"alignSJstitchMismatchNmax\": {\"alignSJstitchMismatchNmax1\": \"0\", \"alignSJstitchMismatchNmax2\": \"-1\", \"alignSJstitchMismatchNmax3\": \"0\", \"alignSJstitchMismatchNmax4\": \"0\"}, \"alignSJDBoverhangMin\": \"1\", \"alignSplicedMateMapLmin\": \"0\", \"alignSplicedMateMapLminOverLmate\": \"0.66\", \"alignWindowsPerReadNmax\": \"10000\", \"alignTranscriptsPerWindowNmax\": \"100\", \"alignTranscriptsPerReadNmax\": \"10000\", \"alignEndsType\": \"Local\", \"peOverlapNbasesMin\": \"0\", \"peOverlapMMp\": \"0.01\"}, \"chim_settings\": {\"chimSegmentMin\": \"12\", \"chimScoreMin\": \"0\", \"chimScoreDropMax\": \"20\", \"chimScoreSeparation\": \"10\", \"chimScoreJunctionNonGTAG\": \"-1\", \"chimJunctionOverhangMin\": \"20\", \"chimSegmentReadGapMax\": \"0\", \"chimFilter\": true, \"chimMainSegmentMultNmax\": \"10\", \"chimMultimapNmax\": \"1\", \"chimMultimapScoreRange\": \"1\"}, \"junction_limits\": {\"limitOutSJoneRead\": \"1000\", \"limitOutSJcollapsed\": \"1000000\", \"limitSjdbInsertNsj\": \"1000000\"}}}, \"chimOutType\": \"\", \"filter\": {\"basic_filters\": [\"exclude_unmapped\"], \"output_params2\": {\"output_select2\": \"yes\", \"__current_case__\": 0, \"outFilterType\": true, \"outFilterMultimapScoreRange\": \"1\", \"outFilterMultimapNmax\": \"20\", \"outFilterMismatchNmax\": \"999\", \"outFilterMismatchNoverLmax\": \"0.3\", \"outFilterMismatchNoverReadLmax\": \"0.04\", \"outFilterScoreMin\": \"0\", \"outFilterScoreMinOverLread\": \"0.66\", \"outFilterMatchNmin\": \"0\", \"outFilterMatchNminOverLread\": \"0.66\", \"outSAMmultNmax\": \"-1\", \"outSAMtlen\": \"1\"}}, \"oformat\": {\"outSAMattributes\": [\"NH\", \"HI\", \"AS\", \"nM\"], \"HI_offset\": \"1\", \"outSAMprimaryFlag\": \"OneBestScore\", \"outSAMmapqUnique\": \"255\"}, \"outWig\": {\"outWigType\": \"bedGraph\", \"__current_case__\": 1, \"outWigTypeSecondWord\": \"\", \"outWigStrand\": true, \"outWigReferencesPrefix\": \"-\", \"outWigNorm\": true}, \"perf\": {\"outBAMsortingBinsN\": \"50\", \"winAnchorMultimapNmax\": \"50\"}, \"refGenomeSource\": {\"geneSource\": \"indexed\", \"__current_case__\": 0, \"GTFconditional\": {\"GTFselect\": \"without-gtf-with-gtf\", \"__current_case__\": 1, \"genomeDir\": {\"__class__\": \"ConnectedValue\"}, \"sjdbGTFfile\": {\"__class__\": \"RuntimeValue\"}, \"sjdbGTFfeatureExon\": \"exon\", \"sjdbOverhang\": \"100\", \"quantmode_output\": {\"quantMode\": \"GeneCounts\", \"__current_case__\": 1}}}, \"singlePaired\": {\"sPaired\": \"single\", \"__current_case__\": 0, \"input1\": {\"__class__\": \"RuntimeValue\"}}, \"twopass\": {\"twopassMode\": \"None\", \"__current_case__\": 0, \"twopass_read_subset\": \"\", \"sj_precalculated\": \"\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.7.10b+galaxy4", + "type": "tool", + "uuid": "b0cd7bb3-88dc-4e5c-b1c7-78929397c245", + "when": null, + "workflow_outputs": [ + { + "label": "output_log", + "output_name": "output_log", + "uuid": "9fdf6357-295b-41cd-98ed-eb8145c45354" + }, + { + "label": "reads_per_gene from STAR", + "output_name": "reads_per_gene", + "uuid": "dd816276-a80e-4f6d-b5a1-5468b2348130" + }, + { + "label": "mapped-reads", + "output_name": "mapped_reads", + "uuid": "57535a90-ff13-4ed3-9fc8-10875b4baae2" + } + ] + }, "14": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", "errors": null, "id": 14, "input_connections": { - "input_param_type|input_param": { - "id": 5, - "output_name": "output" + "results_0|software_cond|input": { + "id": 8, + "output_name": "report" + }, + "results_1|software_cond|output_0|type|input": { + "id": 13, + "output_name": "output_log" + }, + "results_1|software_cond|output_1|type|input": { + "id": 13, + "output_name": "reads_per_gene" } }, "inputs": [], - "label": "combine coverage", - "name": "Map parameter value", + "label": "MultiQC", + "name": "MultiQC", "outputs": [ { - "name": "output_param_boolean", - "type": "expression.json" + "name": "stats", + "type": "input" + }, + { + "name": "plots", + "type": "input" + }, + { + "name": "html_report", + "type": "html" } ], "position": { - "left": 500, - "top": 580 + "left": 1195.211542597603, + "top": 0 }, "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { + "HideDatasetActionplots": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" + "output_name": "plots" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", "tool_shed_repository": { - "changeset_revision": "a01f088d0e5e", - "name": "map_param_value", + "changeset_revision": "abfd8a6544d7", + "name": "multiqc", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"true\"}, {\"__index__\": 1, \"from\": true, \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.1.1", + "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"star\", \"__current_case__\": 28, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"log\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"type\": {\"type\": \"genecounts\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}], \"saveLog\": false, \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.11+galaxy1", "type": "tool", - "uuid": "4e75c9d7-5e55-4e6a-b5fe-b8eaa5f77a6b", + "uuid": "a4e1b954-a475-4a3c-b84a-5dc44947e1c8", "when": null, - "workflow_outputs": [] + "workflow_outputs": [ + { + "label": "MultiQC on input dataset(s): Stats", + "output_name": "stats", + "uuid": "4a60ab44-4c20-40e2-8896-778ddf7c6b93" + }, + { + "label": "MultiQC webpage", + "output_name": "html_report", + "uuid": "bbdeacff-6ca5-4259-940b-3b7bd033f41c" + } + ] }, "15": { "annotation": "", "id": 15, "input_connections": { - "SR fastq input": { - "id": 9, + "STAR BAM": { + "id": 13, "input_subworkflow_step_id": 0, - "output_name": "out1" + "output_name": "mapped_reads" }, - "gtf": { - "id": 3, - "input_subworkflow_step_id": 2, - "output_name": "output" - }, - "reference_genome": { - "id": 2, + "STAR log": { + "id": 13, "input_subworkflow_step_id": 1, - "output_name": "output" - }, - "strandness": { - "id": 4, - "input_subworkflow_step_id": 3, - "output_name": "output" - }, - "when": { - "id": 5, - "output_name": "output" + "output_name": "output_log" } }, "inputs": [], "label": null, - "name": "STAR SR + Coverage splitted", + "name": "Get Uniquely mapped unstranded coverage", "outputs": [], "position": { - "left": 812, - "top": 0 + "left": 1134, + "top": 420 }, "subworkflow": { "a_galaxy_workflow": "true", @@ -582,832 +700,315 @@ "creator": [ { "class": "Person", - "identifier": "https://orcid.org/0000-0002-1964-4960", + "identifier": "0000-0002-1964-4960", "name": "Lucille Delisle" } ], "format-version": "0.1", "license": "MIT", - "name": "STAR SR + Coverage splitted", + "name": "Get Uniquely mapped unstranded coverage", "steps": { "0": { - "annotation": "Should be a list of single-read RNA-seq fastqs", + "annotation": "STAR mapping results (BAM)", "content_id": null, "errors": null, "id": 0, "input_connections": {}, "inputs": [ { - "description": "Should be a list of single-read RNA-seq fastqs", - "name": "SR fastq input" + "description": "STAR mapping results (BAM)", + "name": "STAR BAM" } ], - "label": "SR fastq input", + "label": "STAR BAM", "name": "Input dataset collection", "outputs": [], "position": { "left": 0, - "top": 0.6666717529296875 + "top": 45.91668701171875 }, "tool_id": null, "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", "tool_version": null, "type": "data_collection_input", - "uuid": "4b8c9a0d-6fca-4565-89b4-6da68cc5031b", + "uuid": "d6f1f09b-d56f-43f0-9c09-c7a5a92bb21c", "when": null, "workflow_outputs": [] }, "1": { - "annotation": "reference_genome", + "annotation": "STAR log", "content_id": null, "errors": null, "id": 1, "input_connections": {}, "inputs": [ { - "description": "reference_genome", - "name": "reference_genome" + "description": "STAR log", + "name": "STAR log" } ], - "label": "reference_genome", - "name": "Input parameter", + "label": "STAR log", + "name": "Input dataset collection", "outputs": [], "position": { - "left": 63.0333251953125, - "top": 88.00001525878906 + "left": 40, + "top": 259.91668701171875 }, "tool_id": null, - "tool_state": "{\"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", "tool_version": null, - "type": "parameter_input", - "uuid": "ff4a9932-6ed0-436f-a63c-d6fbe2a582a3", + "type": "data_collection_input", + "uuid": "4d4e4f39-3b7b-4c19-bd8a-08c1236b3052", "when": null, - "workflow_outputs": [ - { - "label": null, - "output_name": "output", - "uuid": "df65576c-d916-4820-8b64-de442a13eae6" - } - ] + "workflow_outputs": [] }, "2": { - "annotation": "gtf compatible with the reference_genome. Mind the UCSC/Ensembl differences in chromosome naming", - "content_id": null, + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.2+galaxy1", "errors": null, "id": 2, - "input_connections": {}, - "inputs": [ + "input_connections": { + "input_bam": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": "keep uniquely mapped reads", + "name": "Filter BAM", + "outputs": [ + { + "name": "out_file2", + "type": "txt" + }, { - "description": "gtf compatible with the reference_genome. Mind the UCSC/Ensembl differences in chromosome naming", - "name": "gtf" + "name": "out_file1", + "type": "bam" } ], - "label": "gtf", - "name": "Input dataset", - "outputs": [], "position": { - "left": 103, - "top": 190.6333465576172 + "left": 260.4666748046875, + "top": 0 }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": \"\"}", - "tool_version": null, - "type": "data_input", - "uuid": "c91756d4-f7f1-4dcc-97f6-da4c96a53c94", + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + }, + "HideDatasetActionout_file2": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file2" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.2+galaxy1", + "tool_shed_repository": { + "changeset_revision": "108db6635177", + "name": "bamtools_filter", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"conditions\": [{\"__index__\": 0, \"filters\": [{\"__index__\": 0, \"bam_property\": {\"bam_property_selector\": \"tag\", \"__current_case__\": 21, \"bam_property_value\": \"NH=1\"}}]}], \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"rule_configuration\": {\"rules_selector\": false, \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.5.2+galaxy1", + "type": "tool", + "uuid": "7cc2377c-657b-4d9d-919b-1a68fd3eceec", "when": null, "workflow_outputs": [] }, "3": { - "annotation": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence", - "content_id": null, + "annotation": "This step get 1 / millions of uniquely mapped reads", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", "errors": null, "id": 3, - "input_connections": {}, - "inputs": [ + "input_connections": { + "infile": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": "get scaling factor", + "name": "Text reformatting", + "outputs": [ { - "description": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence", - "name": "strandness" + "name": "outfile", + "type": "input" } ], - "label": "strandness", - "name": "Input parameter", - "outputs": [], "position": { - "left": 146.6500244140625, - "top": 268.9833221435547 + "left": 319.4666748046875, + "top": 300 }, - "tool_id": null, - "tool_state": "{\"restrictions\": [\"stranded - forward\", \"stranded - reverse\", \"unstranded\"], \"parameter_type\": \"text\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "fd2c51fd-58b3-43b5-b8ce-a919f5325cb7", - "when": null, - "workflow_outputs": [ - { - "label": null, - "output_name": "output", - "uuid": "3d11cf77-35fa-4e39-928c-fbc8b3f6ccd5" + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" } - ] + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"$0~\\\"Uniquely mapped reads number\\\"{print 1000000/$NF}\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "122cd0c2-4484-496c-b589-93b4553d1442", + "when": null, + "workflow_outputs": [] }, "4": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.10b+galaxy3", + "content_id": "param_value_from_file", "errors": null, "id": 4, "input_connections": { - "refGenomeSource|GTFconditional|genomeDir": { - "id": 1, - "output_name": "output" - }, - "refGenomeSource|GTFconditional|sjdbGTFfile": { - "id": 2, - "output_name": "output" - }, - "singlePaired|input1": { - "id": 0, - "output_name": "output" + "input1": { + "id": 3, + "output_name": "outfile" } }, "inputs": [], - "label": "STAR: map and count and coverage splitted", - "name": "RNA STAR", + "label": null, + "name": "Parse parameter value", "outputs": [ { - "name": "output_log", - "type": "txt" - }, - { - "name": "splice_junctions", - "type": "interval" - }, - { - "name": "mapped_reads", - "type": "bam" - }, - { - "name": "reads_per_gene", - "type": "tabular" - }, - { - "name": "signal_unique_str1", - "type": "bedgraph" - }, - { - "name": "signal_uniquemultiple_str1", - "type": "bedgraph" - }, - { - "name": "signal_unique_str2", - "type": "bedgraph" - }, - { - "name": "signal_uniquemultiple_str2", - "type": "bedgraph" + "name": "float_param", + "type": "expression.json" } ], "position": { - "left": 533.25, - "top": 0.0 + "left": 584.4666748046875, + "top": 327 }, "post_job_actions": { - "HideDatasetActionsignal_unique_str1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "signal_unique_str1" - }, - "HideDatasetActionsignal_unique_str2": { + "HideDatasetActionfloat_param": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "signal_unique_str2" - }, - "HideDatasetActionsignal_uniquemultiple_str1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "signal_uniquemultiple_str1" - }, - "HideDatasetActionsignal_uniquemultiple_str2": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "signal_uniquemultiple_str2" + "output_name": "float_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"float\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "ae839aba-23c4-4633-9ffd-08c6becbb9e8", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.30.0", + "errors": null, + "id": 5, + "input_connections": { + "input_type|input": { + "id": 2, + "output_name": "out_file1" }, - "HideDatasetActionsplice_junctions": { + "report|scale": { + "id": 4, + "output_name": "float_param" + } + }, + "inputs": [], + "label": "Scaled Coverage both strands combined", + "name": "bedtools Genome Coverage", + "outputs": [ + { + "name": "output", + "type": "bedgraph" + } + ], + "position": { + "left": 855.418361599966, + "top": 226.99244090393722 + }, + "post_job_actions": { + "HideDatasetActionoutput": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "splice_junctions" + "output_name": "output" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.10b+galaxy3", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.30.0", "tool_shed_repository": { - "changeset_revision": "3ea5a2a63fa2", - "name": "rgrnastar", + "changeset_revision": "fe5b4cb8356c", + "name": "bedtools", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"algo\": {\"params\": {\"settingsType\": \"full\", \"__current_case__\": 3, \"seed\": {\"seedSearchStartLmax\": \"50\", \"seedSearchStartLmaxOverLread\": \"1.0\", \"seedSearchLmax\": \"0\", \"seedMultimapNmax\": \"10000\", \"seedPerReadNmax\": \"1000\", \"seedPerWindowNmax\": \"50\", \"seedNoneLociPerWindow\": \"10\"}, \"align\": {\"alignIntronMin\": \"20\", \"alignIntronMax\": \"1000000\", \"alignMatesGapMax\": \"1000000\", \"alignSJoverhangMin\": \"8\", \"alignSJstitchMismatchNmax\": {\"alignSJstitchMismatchNmax1\": \"0\", \"alignSJstitchMismatchNmax2\": \"-1\", \"alignSJstitchMismatchNmax3\": \"0\", \"alignSJstitchMismatchNmax4\": \"0\"}, \"alignSJDBoverhangMin\": \"1\", \"alignSplicedMateMapLmin\": \"0\", \"alignSplicedMateMapLminOverLmate\": \"0.66\", \"alignWindowsPerReadNmax\": \"10000\", \"alignTranscriptsPerWindowNmax\": \"100\", \"alignTranscriptsPerReadNmax\": \"10000\", \"alignEndsType\": \"Local\", \"peOverlapNbasesMin\": \"0\", \"peOverlapMMp\": \"0.01\"}, \"chim_settings\": {\"chimSegmentMin\": \"12\", \"chimScoreMin\": \"0\", \"chimScoreDropMax\": \"20\", \"chimScoreSeparation\": \"10\", \"chimScoreJunctionNonGTAG\": \"-1\", \"chimJunctionOverhangMin\": \"20\", \"chimSegmentReadGapMax\": \"0\", \"chimFilter\": true, \"chimMainSegmentMultNmax\": \"10\", \"chimMultimapNmax\": \"1\", \"chimMultimapScoreRange\": \"1\"}, \"junction_limits\": {\"limitOutSJoneRead\": \"1000\", \"limitOutSJcollapsed\": \"1000000\", \"limitSjdbInsertNsj\": \"1000000\"}}}, \"chimOutType\": \"\", \"filter\": {\"basic_filters\": [\"exclude_unmapped\"], \"output_params2\": {\"output_select2\": \"yes\", \"__current_case__\": 0, \"outFilterType\": true, \"outFilterMultimapScoreRange\": \"1\", \"outFilterMultimapNmax\": \"20\", \"outFilterMismatchNmax\": \"999\", \"outFilterMismatchNoverLmax\": \"0.3\", \"outFilterMismatchNoverReadLmax\": \"0.04\", \"outFilterScoreMin\": \"0\", \"outFilterScoreMinOverLread\": \"0.66\", \"outFilterMatchNmin\": \"0\", \"outFilterMatchNminOverLread\": \"0.66\", \"outSAMmultNmax\": \"-1\", \"outSAMtlen\": \"1\"}}, \"oformat\": {\"outSAMattributes\": [\"NH\", \"HI\", \"AS\", \"nM\"], \"HI_offset\": \"1\", \"outSAMprimaryFlag\": \"OneBestScore\", \"outSAMmapqUnique\": \"255\"}, \"outWig\": {\"outWigType\": \"bedGraph\", \"__current_case__\": 1, \"outWigTypeSecondWord\": \"\", \"outWigStrand\": true, \"outWigReferencesPrefix\": \"-\", \"outWigNorm\": true}, \"perf\": {\"outBAMsortingBinsN\": \"50\", \"winAnchorMultimapNmax\": \"50\"}, \"refGenomeSource\": {\"geneSource\": \"indexed\", \"__current_case__\": 0, \"GTFconditional\": {\"GTFselect\": \"without-gtf-with-gtf\", \"__current_case__\": 1, \"genomeDir\": {\"__class__\": \"ConnectedValue\"}, \"sjdbGTFfile\": {\"__class__\": \"ConnectedValue\"}, \"sjdbOverhang\": \"100\", \"quantmode_output\": {\"quantMode\": \"GeneCounts\", \"__current_case__\": 1}}}, \"singlePaired\": {\"sPaired\": \"single\", \"__current_case__\": 0, \"input1\": {\"__class__\": \"ConnectedValue\"}}, \"twopass\": {\"twopassMode\": \"None\", \"__current_case__\": 0, \"twopass_read_subset\": \"\", \"sj_precalculated\": \"\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.7.10b+galaxy3", + "tool_state": "{\"d\": false, \"dz\": false, \"five\": false, \"input_type\": {\"input_type_select\": \"bam\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}, \"report\": {\"report_select\": \"bg\", \"__current_case__\": 0, \"zero_regions\": false, \"scale\": {\"__class__\": \"ConnectedValue\"}}, \"split\": true, \"strand\": \"\", \"three\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.30.0", "type": "tool", - "uuid": "49fb2364-339b-4524-befb-c983f97d2a7a", + "uuid": "ef9e0577-c831-4cad-8fae-67ceaf0550fa", "when": null, - "workflow_outputs": [ - { - "label": "output_log", - "output_name": "output_log", - "uuid": "9fdf6357-295b-41cd-98ed-eb8145c45354" - }, - { - "label": "mapped-reads", - "output_name": "mapped_reads", - "uuid": "57535a90-ff13-4ed3-9fc8-10875b4baae2" - }, - { - "label": "reads_per_gene from STAR", - "output_name": "reads_per_gene", - "uuid": "dd816276-a80e-4f6d-b5a1-5468b2348130" - } - ] + "workflow_outputs": [] }, - "5": { + "6": { "annotation": "", - "id": 5, + "content_id": "wig_to_bigWig", + "errors": null, + "id": 6, "input_connections": { - "Bedgraph strand 1": { - "id": 4, - "input_subworkflow_step_id": 1, - "output_name": "signal_unique_str1" - }, - "Bedgraph strand 2": { - "id": 4, - "input_subworkflow_step_id": 2, - "output_name": "signal_unique_str2" - }, - "strandness": { - "id": 3, - "input_subworkflow_step_id": 0, + "input1": { + "id": 5, "output_name": "output" } }, - "inputs": [ + "inputs": [], + "label": "convert both strands coverage to bigwig", + "name": "Wig/BedGraph-to-bigWig", + "outputs": [ { - "description": "", - "name": "Convert to bigwig" + "name": "out_file1", + "type": "bigwig" } ], - "label": "Convert to bigwig", - "name": "Re-arrange Stranded RNA-seq coverage", - "outputs": [], "position": { - "left": 900.86669921875, - "top": 212.46665954589844 + "left": 1104.4183615999664, + "top": 298.7166748046875 }, - "subworkflow": { - "a_galaxy_workflow": "true", - "annotation": "", - "creator": [ - { - "class": "Person", - "identifier": "https://orcid.org/0000-0002-1964-4960", - "name": "Lucille Delisle" - } - ], - "format-version": "0.1", - "license": "MIT", - "name": "Re-arrange Stranded RNA-seq coverage", - "steps": { - "0": { - "annotation": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence", - "content_id": null, - "errors": null, - "id": 0, - "input_connections": {}, - "inputs": [ - { - "description": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence", - "name": "strandness" - } - ], - "label": "strandness", - "name": "Input parameter", - "outputs": [], - "position": { - "left": 0, - "top": 86.19999694824209 - }, - "tool_id": null, - "tool_state": "{\"restrictions\": [\"stranded - forward\", \"stranded - reverse\", \"unstranded\"], \"parameter_type\": \"text\", \"optional\": false}", - "tool_version": null, - "type": "parameter_input", - "uuid": "630bd9ab-da3a-4b98-a073-0c2e12af195a", - "when": null, - "workflow_outputs": [ - { - "label": null, - "output_name": "output", - "uuid": "61da049f-3933-4a5f-acc2-47419d81d136" - } - ] - }, - "1": { - "annotation": "From STAR strand 1", - "content_id": null, - "errors": null, - "id": 1, - "input_connections": {}, - "inputs": [ - { - "description": "From STAR strand 1", - "name": "Bedgraph strand 1" - } - ], - "label": "Bedgraph strand 1", - "name": "Input dataset collection", - "outputs": [], - "position": { - "left": 62.75, - "top": 182.01666259765614 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bedgraph\"], \"tag\": null, \"collection_type\": \"list\"}", - "tool_version": null, - "type": "data_collection_input", - "uuid": "fa1b2712-805a-47f7-95d7-b1d2957a36a5", - "when": null, - "workflow_outputs": [] - }, - "2": { - "annotation": "From STAR strand 2", - "content_id": null, - "errors": null, - "id": 2, - "input_connections": {}, - "inputs": [ - { - "description": "From STAR strand 2", - "name": "Bedgraph strand 2" - } - ], - "label": "Bedgraph strand 2", - "name": "Input dataset collection", - "outputs": [], - "position": { - "left": 124.7500000000002, - "top": 291.0166625976562 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"format\": [\"bedgraph\"], \"tag\": null, \"collection_type\": \"list\"}", - "tool_version": null, - "type": "data_collection_input", - "uuid": "79aee01a-2ba4-42c4-802d-975f955651ee", - "when": null, - "workflow_outputs": [] - }, - "3": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1", - "errors": null, - "id": 3, - "input_connections": { - "input_param_type|input_param": { - "id": 0, - "output_name": "output" - } - }, - "inputs": [], - "label": "Get replacement for strand1", - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_text", - "type": "expression.json" - } - ], - "position": { - "left": 445, - "top": 105 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - }, - "HideDatasetActionoutput_param_text": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_text" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1", - "tool_shed_repository": { - "changeset_revision": "a01f088d0e5e", - "name": "map_param_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"stranded - forward\", \"to\": \"$1_forward\"}, {\"__index__\": 1, \"from\": \"stranded - reverse\", \"to\": \"$1_reverse\"}, {\"__index__\": 2, \"from\": \"unstranded\", \"to\": \"$1_forward\"}]}, \"output_param_type\": \"text\", \"unmapped\": {\"on_unmapped\": \"fail\", \"__current_case__\": 1}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.1.1", - "type": "tool", - "uuid": "e51b1ec5-6ac7-45c2-95e3-12ab8c027ff0", - "when": null, - "workflow_outputs": [] - }, - "4": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1", - "errors": null, - "id": 4, - "input_connections": { - "input_param_type|input_param": { - "id": 0, - "output_name": "output" - } - }, - "inputs": [], - "label": "Get replacement for strand2", - "name": "Map parameter value", - "outputs": [ - { - "name": "output_param_text", - "type": "expression.json" - } - ], - "position": { - "left": 491, - "top": 283 - }, - "post_job_actions": { - "HideDatasetActionoutput_param_boolean": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_boolean" - }, - "HideDatasetActionoutput_param_text": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output_param_text" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1", - "tool_shed_repository": { - "changeset_revision": "a01f088d0e5e", - "name": "map_param_value", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"stranded - forward\", \"to\": \"$1_reverse\"}, {\"__index__\": 1, \"from\": \"stranded - reverse\", \"to\": \"$1_forward\"}, {\"__index__\": 2, \"from\": \"unstranded\", \"to\": \"$1_reverse\"}]}, \"output_param_type\": \"text\", \"unmapped\": {\"on_unmapped\": \"fail\", \"__current_case__\": 1}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.1.1", - "type": "tool", - "uuid": "b7588e70-d204-4630-99e4-f554a22ee2fe", - "when": null, - "workflow_outputs": [] - }, - "5": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", - "errors": null, - "id": 5, - "input_connections": { - "input_collection": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": "get identifiers", - "name": "Extract element identifiers", - "outputs": [ - { - "name": "output", - "type": "txt" - } - ], - "position": { - "left": 351.00000000000017, - "top": 0 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", - "tool_shed_repository": { - "changeset_revision": "d3c07d270a50", - "name": "collection_element_identifiers", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.0.2", - "type": "tool", - "uuid": "274e53f9-17f8-45aa-960a-1ef619648c7c", - "when": null, - "workflow_outputs": [] - }, - "6": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.4", - "errors": null, - "id": 6, - "input_connections": { - "find_and_replace_0|replace_pattern": { - "id": 3, - "output_name": "output_param_text" - }, - "infile": { - "id": 5, - "output_name": "output" - } - }, - "inputs": [], - "label": "New labels strand 1", - "name": "Replace", - "outputs": [ - { - "name": "outfile", - "type": "input" - } - ], - "position": { - "left": 782, - "top": 76 - }, - "post_job_actions": { - "HideDatasetActionoutfile": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "outfile" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.4", - "tool_shed_repository": { - "changeset_revision": "d698c222f354", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"find_and_replace\": [{\"__index__\": 0, \"find_pattern\": \"^(.+)$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"is_regex\": true, \"global\": true, \"caseinsensitive\": false, \"wholewords\": false, \"skip_first_line\": false, \"searchwhere\": {\"searchwhere_select\": \"line\", \"__current_case__\": 0}}], \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.4", - "type": "tool", - "uuid": "11b98d13-5c13-464e-b223-8fab20f69f62", - "when": null, - "workflow_outputs": [] - }, - "7": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.4", - "errors": null, - "id": 7, - "input_connections": { - "find_and_replace_0|replace_pattern": { - "id": 4, - "output_name": "output_param_text" - }, - "infile": { - "id": 5, - "output_name": "output" - } - }, - "inputs": [], - "label": "New labels strand 2", - "name": "Replace", - "outputs": [ - { - "name": "outfile", - "type": "input" - } - ], - "position": { - "left": 821, - "top": 276 - }, - "post_job_actions": { - "HideDatasetActionoutfile": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "outfile" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.4", - "tool_shed_repository": { - "changeset_revision": "d698c222f354", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"find_and_replace\": [{\"__index__\": 0, \"find_pattern\": \"^(.+)$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"is_regex\": true, \"global\": true, \"caseinsensitive\": false, \"wholewords\": false, \"skip_first_line\": false, \"searchwhere\": {\"searchwhere_select\": \"line\", \"__current_case__\": 0}}], \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.4", - "type": "tool", - "uuid": "4e158197-8591-4fce-b969-9002f7482634", - "when": null, - "workflow_outputs": [] - }, - "8": { - "annotation": "", - "content_id": "__RELABEL_FROM_FILE__", - "errors": null, - "id": 8, - "input_connections": { - "how|labels": { - "id": 6, - "output_name": "outfile" - }, - "input": { - "id": 1, - "output_name": "output" - } - }, - "inputs": [], - "label": "Relabelled strand 1", - "name": "Relabel identifiers", - "outputs": [ - { - "name": "output", - "type": "input" - } - ], - "position": { - "left": 1056, - "top": 176.99999999999994 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } - }, - "tool_id": "__RELABEL_FROM_FILE__", - "tool_state": "{\"how\": {\"how_select\": \"txt\", \"__current_case__\": 0, \"labels\": {\"__class__\": \"ConnectedValue\"}, \"strict\": false}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.0.0", - "type": "tool", - "uuid": "6a3f57c0-f6d6-468f-8ac9-b6882f754eed", - "when": null, - "workflow_outputs": [] - }, - "9": { - "annotation": "", - "content_id": "__RELABEL_FROM_FILE__", - "errors": null, - "id": 9, - "input_connections": { - "how|labels": { - "id": 7, - "output_name": "outfile" - }, - "input": { - "id": 2, - "output_name": "output" - } - }, - "inputs": [], - "label": "Relabelled strand 2", - "name": "Relabel identifiers", - "outputs": [ - { - "name": "output", - "type": "input" - } - ], - "position": { - "left": 1077, - "top": 324.99999999999994 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } - }, - "tool_id": "__RELABEL_FROM_FILE__", - "tool_state": "{\"how\": {\"how_select\": \"txt\", \"__current_case__\": 0, \"labels\": {\"__class__\": \"ConnectedValue\"}, \"strict\": false}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.0.0", - "type": "tool", - "uuid": "d181b9ba-0cd3-4de6-8e82-c53a97c5ae67", - "when": null, - "workflow_outputs": [] - }, - "10": { - "annotation": "", - "content_id": "__MERGE_COLLECTION__", - "errors": null, - "id": 10, - "input_connections": { - "inputs_0|input": { - "id": 8, - "output_name": "output" - }, - "inputs_1|input": { - "id": 9, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Merge collections", - "outputs": [ - { - "name": "output", - "type": "input" - } - ], - "position": { - "left": 1360.7832000000906, - "top": 265.99999999999994 - }, - "post_job_actions": { - "HideDatasetActionoutput": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "output" - } - }, - "tool_id": "__MERGE_COLLECTION__", - "tool_state": "{\"advanced\": {\"conflict\": {\"duplicate_options\": \"keep_first\", \"__current_case__\": 3}}, \"inputs\": [{\"__index__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.0.0", - "type": "tool", - "uuid": "4b4b9d77-13fe-4b8a-a5af-e0857547521e", - "when": null, - "workflow_outputs": [] + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "both strands coverage" }, - "11": { - "annotation": "", - "content_id": "wig_to_bigWig", - "errors": null, - "id": 11, - "input_connections": { - "input1": { - "id": 10, - "output_name": "output" - } - }, - "inputs": [], - "label": "convert to bigwig", - "name": "Wig/BedGraph-to-bigWig", - "outputs": [ - { - "name": "out_file1", - "type": "bigwig" - } - ], - "position": { - "left": 1624.7832000000903, - "top": 317.99999999999994 - }, - "post_job_actions": { - "RenameDatasetActionout_file1": { - "action_arguments": { - "newname": "uniquely mapped stranded coverage" - }, - "action_type": "RenameDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "wig_to_bigWig", - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.1", - "type": "tool", - "uuid": "b69eee65-c37e-4c75-8127-b78185b130db", - "when": null, - "workflow_outputs": [ - { - "label": "stranded coverage", - "output_name": "out_file1", - "uuid": "dd43e657-0116-46ad-9cc9-c12fb871988c" - } - ] - } - }, - "tags": "", - "uuid": "60274653-a1c5-4178-bd64-23d3716247f6" + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } }, - "tool_id": null, - "type": "subworkflow", - "uuid": "db4d9fe7-d2b4-4f62-9071-441f1c4c9033", + "tool_id": "wig_to_bigWig", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.1", + "type": "tool", + "uuid": "1260fbcb-0521-4957-842f-d9b4fd124a1a", "when": null, "workflow_outputs": [ { - "label": "stranded coverage", - "output_name": "stranded coverage", - "uuid": "d02c678e-caf3-410f-8755-f5712b146615" - }, - { - "label": null, - "output_name": "0:output", - "uuid": "81b53f36-85da-4b70-af7d-2cc62e22ac81" + "label": "both strands coverage", + "output_name": "out_file1", + "uuid": "acac3057-9854-4236-a02d-e084b4bab1e4" } ] } }, "tags": "", - "uuid": "99544459-9820-4521-ae66-171d8a8a1b33" + "uuid": "b8f2e925-5cc7-46a6-a55f-dc7b4bd5929c" }, "tool_id": null, "type": "subworkflow", - "uuid": "6e30316a-32d3-4b6b-bee3-ee069979f182", - "when": "$(inputs.when)", + "uuid": "9fbcf8ab-3e46-4ec6-9fc1-8b1ed61688d8", + "when": null, "workflow_outputs": [ { - "label": "stranded coverage", - "output_name": "stranded coverage", - "uuid": "92e691cb-ef50-4505-83c8-9661ef75e513" + "label": "both strands coverage", + "output_name": "both strands coverage", + "uuid": "ed4b91ff-c2d2-4668-95c6-479e2ffc8d1e" } ] }, @@ -1415,33 +1016,29 @@ "annotation": "", "id": 16, "input_connections": { - "SR fastq input": { - "id": 0, - "input_subworkflow_step_id": 0, - "output_name": "output" + "Bedgraph strand 1": { + "id": 13, + "input_subworkflow_step_id": 1, + "output_name": "signal_unique_str1" }, - "gtf": { - "id": 3, + "Bedgraph strand 2": { + "id": 13, "input_subworkflow_step_id": 2, - "output_name": "output" + "output_name": "signal_unique_str2" }, - "reference_genome": { - "id": 2, - "input_subworkflow_step_id": 1, + "strandness": { + "id": 4, + "input_subworkflow_step_id": 0, "output_name": "output" - }, - "when": { - "id": 14, - "output_name": "output_param_boolean" } }, "inputs": [], "label": null, - "name": "STAR SR + Coverage combined", + "name": "Re-arrange Stranded RNA-seq coverage", "outputs": [], "position": { - "left": 806, - "top": 386 + "left": 1144, + "top": 591 }, "subworkflow": { "a_galaxy_workflow": "true", @@ -1455,448 +1052,546 @@ ], "format-version": "0.1", "license": "MIT", - "name": "STAR SR + Coverage combined", + "name": "Re-arrange Stranded RNA-seq coverage", "steps": { "0": { - "annotation": "Should be a list of single-read RNA-seq fastqs", + "annotation": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence", "content_id": null, "errors": null, "id": 0, "input_connections": {}, "inputs": [ { - "description": "Should be a list of single-read RNA-seq fastqs", - "name": "SR fastq input" + "description": "For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence", + "name": "strandness" } ], - "label": "SR fastq input", - "name": "Input dataset collection", + "label": "strandness", + "name": "Input parameter", "outputs": [], "position": { "left": 0, - "top": 0.6666717529296875 + "top": 86.19999694824209 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", + "tool_state": "{\"restrictions\": [\"stranded - forward\", \"stranded - reverse\", \"unstranded\"], \"parameter_type\": \"text\", \"optional\": false}", "tool_version": null, - "type": "data_collection_input", - "uuid": "4b8c9a0d-6fca-4565-89b4-6da68cc5031b", + "type": "parameter_input", + "uuid": "630bd9ab-da3a-4b98-a073-0c2e12af195a", "when": null, "workflow_outputs": [] }, "1": { - "annotation": "reference_genome", + "annotation": "From STAR strand 1", "content_id": null, "errors": null, "id": 1, "input_connections": {}, "inputs": [ { - "description": "reference_genome", - "name": "reference_genome" + "description": "From STAR strand 1", + "name": "Bedgraph strand 1" } ], - "label": "reference_genome", - "name": "Input parameter", + "label": "Bedgraph strand 1", + "name": "Input dataset collection", "outputs": [], "position": { - "left": 63.0333251953125, - "top": 88.00001525878906 + "left": 62.75, + "top": 182.01666259765614 }, "tool_id": null, - "tool_state": "{\"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_state": "{\"optional\": false, \"format\": [\"bedgraph\"], \"tag\": null, \"collection_type\": \"list\"}", "tool_version": null, - "type": "parameter_input", - "uuid": "ff4a9932-6ed0-436f-a63c-d6fbe2a582a3", + "type": "data_collection_input", + "uuid": "fa1b2712-805a-47f7-95d7-b1d2957a36a5", "when": null, - "workflow_outputs": [ - { - "label": null, - "output_name": "output", - "uuid": "7c27b18d-f909-42b4-aea9-0a37dd3b5fb1" - } - ] + "workflow_outputs": [] }, "2": { - "annotation": "gtf compatible with the reference_genome. Mind the UCSC/Ensembl differences in chromosome naming", + "annotation": "From STAR strand 2", "content_id": null, "errors": null, "id": 2, "input_connections": {}, "inputs": [ { - "description": "gtf compatible with the reference_genome. Mind the UCSC/Ensembl differences in chromosome naming", - "name": "gtf" + "description": "From STAR strand 2", + "name": "Bedgraph strand 2" } ], - "label": "gtf", - "name": "Input dataset", + "label": "Bedgraph strand 2", + "name": "Input dataset collection", "outputs": [], "position": { - "left": 103, - "top": 190.6333465576172 + "left": 124.7500000000002, + "top": 291.0166625976562 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_state": "{\"optional\": false, \"format\": [\"bedgraph\"], \"tag\": null, \"collection_type\": \"list\"}", "tool_version": null, - "type": "data_input", - "uuid": "c91756d4-f7f1-4dcc-97f6-da4c96a53c94", + "type": "data_collection_input", + "uuid": "79aee01a-2ba4-42c4-802d-975f955651ee", "when": null, "workflow_outputs": [] }, "3": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.10b+galaxy3", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1", "errors": null, "id": 3, "input_connections": { - "refGenomeSource|GTFconditional|genomeDir": { - "id": 1, - "output_name": "output" - }, - "refGenomeSource|GTFconditional|sjdbGTFfile": { - "id": 2, - "output_name": "output" - }, - "singlePaired|input1": { + "input_param_type|input_param": { "id": 0, "output_name": "output" } }, "inputs": [], - "label": "STAR: map and count and coverage splitted", - "name": "RNA STAR", + "label": "Get replacement for strand1", + "name": "Map parameter value", "outputs": [ { - "name": "output_log", - "type": "txt" - }, - { - "name": "splice_junctions", - "type": "interval" - }, - { - "name": "mapped_reads", - "type": "bam" - }, - { - "name": "reads_per_gene", - "type": "tabular" - }, - { - "name": "signal_unique_str1", - "type": "bedgraph" - }, - { - "name": "signal_uniquemultiple_str1", - "type": "bedgraph" + "name": "output_param_text", + "type": "expression.json" } ], "position": { - "left": 533.25, - "top": 0 + "left": 445, + "top": 105 }, "post_job_actions": { - "HideDatasetActionsignal_unique_str1": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "signal_unique_str1" - }, - "HideDatasetActionsignal_unique_str2": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "signal_unique_str2" - }, - "HideDatasetActionsignal_uniquemultiple_str1": { + "HideDatasetActionoutput_param_boolean": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "signal_uniquemultiple_str1" + "output_name": "output_param_boolean" }, - "HideDatasetActionsignal_uniquemultiple_str2": { + "HideDatasetActionoutput_param_text": { "action_arguments": {}, "action_type": "HideDatasetAction", - "output_name": "signal_uniquemultiple_str2" - }, - "HideDatasetActionsplice_junctions": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "splice_junctions" + "output_name": "output_param_text" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.10b+galaxy3", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1", "tool_shed_repository": { - "changeset_revision": "3ea5a2a63fa2", - "name": "rgrnastar", + "changeset_revision": "a01f088d0e5e", + "name": "map_param_value", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"algo\": {\"params\": {\"settingsType\": \"full\", \"__current_case__\": 3, \"seed\": {\"seedSearchStartLmax\": \"50\", \"seedSearchStartLmaxOverLread\": \"1.0\", \"seedSearchLmax\": \"0\", \"seedMultimapNmax\": \"10000\", \"seedPerReadNmax\": \"1000\", \"seedPerWindowNmax\": \"50\", \"seedNoneLociPerWindow\": \"10\"}, \"align\": {\"alignIntronMin\": \"20\", \"alignIntronMax\": \"1000000\", \"alignMatesGapMax\": \"1000000\", \"alignSJoverhangMin\": \"8\", \"alignSJstitchMismatchNmax\": {\"alignSJstitchMismatchNmax1\": \"0\", \"alignSJstitchMismatchNmax2\": \"-1\", \"alignSJstitchMismatchNmax3\": \"0\", \"alignSJstitchMismatchNmax4\": \"0\"}, \"alignSJDBoverhangMin\": \"1\", \"alignSplicedMateMapLmin\": \"0\", \"alignSplicedMateMapLminOverLmate\": \"0.66\", \"alignWindowsPerReadNmax\": \"10000\", \"alignTranscriptsPerWindowNmax\": \"100\", \"alignTranscriptsPerReadNmax\": \"10000\", \"alignEndsType\": \"Local\", \"peOverlapNbasesMin\": \"0\", \"peOverlapMMp\": \"0.01\"}, \"chim_settings\": {\"chimSegmentMin\": \"12\", \"chimScoreMin\": \"0\", \"chimScoreDropMax\": \"20\", \"chimScoreSeparation\": \"10\", \"chimScoreJunctionNonGTAG\": \"-1\", \"chimJunctionOverhangMin\": \"20\", \"chimSegmentReadGapMax\": \"0\", \"chimFilter\": true, \"chimMainSegmentMultNmax\": \"10\", \"chimMultimapNmax\": \"1\", \"chimMultimapScoreRange\": \"1\"}, \"junction_limits\": {\"limitOutSJoneRead\": \"1000\", \"limitOutSJcollapsed\": \"1000000\", \"limitSjdbInsertNsj\": \"1000000\"}}}, \"chimOutType\": \"\", \"filter\": {\"basic_filters\": [\"exclude_unmapped\"], \"output_params2\": {\"output_select2\": \"yes\", \"__current_case__\": 0, \"outFilterType\": true, \"outFilterMultimapScoreRange\": \"1\", \"outFilterMultimapNmax\": \"20\", \"outFilterMismatchNmax\": \"999\", \"outFilterMismatchNoverLmax\": \"0.3\", \"outFilterMismatchNoverReadLmax\": \"0.04\", \"outFilterScoreMin\": \"0\", \"outFilterScoreMinOverLread\": \"0.66\", \"outFilterMatchNmin\": \"0\", \"outFilterMatchNminOverLread\": \"0.66\", \"outSAMmultNmax\": \"-1\", \"outSAMtlen\": \"1\"}}, \"oformat\": {\"outSAMattributes\": [\"NH\", \"HI\", \"AS\", \"nM\"], \"HI_offset\": \"1\", \"outSAMprimaryFlag\": \"OneBestScore\", \"outSAMmapqUnique\": \"255\"}, \"outWig\": {\"outWigType\": \"bedGraph\", \"__current_case__\": 1, \"outWigTypeSecondWord\": \"\", \"outWigStrand\": false, \"outWigReferencesPrefix\": \"-\", \"outWigNorm\": true}, \"perf\": {\"outBAMsortingBinsN\": \"50\", \"winAnchorMultimapNmax\": \"50\"}, \"refGenomeSource\": {\"geneSource\": \"indexed\", \"__current_case__\": 0, \"GTFconditional\": {\"GTFselect\": \"without-gtf-with-gtf\", \"__current_case__\": 1, \"genomeDir\": {\"__class__\": \"ConnectedValue\"}, \"sjdbGTFfile\": {\"__class__\": \"ConnectedValue\"}, \"sjdbOverhang\": \"100\", \"quantmode_output\": {\"quantMode\": \"GeneCounts\", \"__current_case__\": 1}}}, \"singlePaired\": {\"sPaired\": \"single\", \"__current_case__\": 0, \"input1\": {\"__class__\": \"ConnectedValue\"}}, \"twopass\": {\"twopassMode\": \"None\", \"__current_case__\": 0, \"twopass_read_subset\": \"\", \"sj_precalculated\": \"\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.7.10b+galaxy3", + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"stranded - forward\", \"to\": \"$1_forward\"}, {\"__index__\": 1, \"from\": \"stranded - reverse\", \"to\": \"$1_reverse\"}, {\"__index__\": 2, \"from\": \"unstranded\", \"to\": \"$1_forward\"}]}, \"output_param_type\": \"text\", \"unmapped\": {\"on_unmapped\": \"fail\", \"__current_case__\": 1}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.1", "type": "tool", - "uuid": "49fb2364-339b-4524-befb-c983f97d2a7a", + "uuid": "e51b1ec5-6ac7-45c2-95e3-12ab8c027ff0", "when": null, - "workflow_outputs": [ - { - "label": "output_log", - "output_name": "output_log", - "uuid": "9fdf6357-295b-41cd-98ed-eb8145c45354" - }, - { - "label": "mapped-reads", - "output_name": "mapped_reads", - "uuid": "57535a90-ff13-4ed3-9fc8-10875b4baae2" - }, - { - "label": "reads_per_gene from STAR", - "output_name": "reads_per_gene", - "uuid": "dd816276-a80e-4f6d-b5a1-5468b2348130" - } - ] + "workflow_outputs": [] }, "4": { "annotation": "", - "content_id": "wig_to_bigWig", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1", "errors": null, "id": 4, "input_connections": { - "input1": { - "id": 3, - "output_name": "signal_unique_str1" + "input_param_type|input_param": { + "id": 0, + "output_name": "output" } }, "inputs": [], - "label": "convert both strands coverage to bigwig", - "name": "Wig/BedGraph-to-bigWig", + "label": "Get replacement for strand2", + "name": "Map parameter value", "outputs": [ { - "name": "out_file1", - "type": "bigwig" + "name": "output_param_text", + "type": "expression.json" } ], "position": { - "left": 932.449951171875, - "top": 160.79998779296875 + "left": 491, + "top": 283 }, "post_job_actions": { - "RenameDatasetActionout_file1": { - "action_arguments": { - "newname": "both strands coverage" - }, - "action_type": "RenameDatasetAction", - "output_name": "out_file1" + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + }, + "HideDatasetActionoutput_param_text": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_text" } }, - "tool_id": "wig_to_bigWig", - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.1", - "type": "tool", - "uuid": "feab1d4c-67df-4f27-ac5a-f6a6791c0c7e", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1", + "tool_shed_repository": { + "changeset_revision": "a01f088d0e5e", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"stranded - forward\", \"to\": \"$1_reverse\"}, {\"__index__\": 1, \"from\": \"stranded - reverse\", \"to\": \"$1_forward\"}, {\"__index__\": 2, \"from\": \"unstranded\", \"to\": \"$1_reverse\"}]}, \"output_param_type\": \"text\", \"unmapped\": {\"on_unmapped\": \"fail\", \"__current_case__\": 1}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.1", + "type": "tool", + "uuid": "b7588e70-d204-4630-99e4-f554a22ee2fe", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "errors": null, + "id": 5, + "input_connections": { + "input_collection": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": "get identifiers", + "name": "Extract element identifiers", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 351.00000000000017, + "top": 0 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.0.2", + "type": "tool", + "uuid": "274e53f9-17f8-45aa-960a-1ef619648c7c", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.4", + "errors": null, + "id": 6, + "input_connections": { + "find_and_replace_0|replace_pattern": { + "id": 3, + "output_name": "output_param_text" + }, + "infile": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [], + "label": "New labels strand 1", + "name": "Replace", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 782, + "top": 76 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.4", + "tool_shed_repository": { + "changeset_revision": "d698c222f354", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"find_and_replace\": [{\"__index__\": 0, \"find_pattern\": \"^(.+)$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"is_regex\": true, \"global\": true, \"caseinsensitive\": false, \"wholewords\": false, \"skip_first_line\": false, \"searchwhere\": {\"searchwhere_select\": \"line\", \"__current_case__\": 0}}], \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.4", + "type": "tool", + "uuid": "11b98d13-5c13-464e-b223-8fab20f69f62", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.4", + "errors": null, + "id": 7, + "input_connections": { + "find_and_replace_0|replace_pattern": { + "id": 4, + "output_name": "output_param_text" + }, + "infile": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [], + "label": "New labels strand 2", + "name": "Replace", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 821, + "top": 276 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.4", + "tool_shed_repository": { + "changeset_revision": "d698c222f354", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"find_and_replace\": [{\"__index__\": 0, \"find_pattern\": \"^(.+)$\", \"replace_pattern\": {\"__class__\": \"ConnectedValue\"}, \"is_regex\": true, \"global\": true, \"caseinsensitive\": false, \"wholewords\": false, \"skip_first_line\": false, \"searchwhere\": {\"searchwhere_select\": \"line\", \"__current_case__\": 0}}], \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.4", + "type": "tool", + "uuid": "4e158197-8591-4fce-b969-9002f7482634", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "__RELABEL_FROM_FILE__", + "errors": null, + "id": 8, + "input_connections": { + "how|labels": { + "id": 6, + "output_name": "outfile" + }, + "input": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": "Relabelled strand 1", + "name": "Relabel identifiers", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 1056, + "top": 176.99999999999994 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__RELABEL_FROM_FILE__", + "tool_state": "{\"how\": {\"how_select\": \"txt\", \"__current_case__\": 0, \"labels\": {\"__class__\": \"ConnectedValue\"}, \"strict\": false}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "6a3f57c0-f6d6-468f-8ac9-b6882f754eed", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "__RELABEL_FROM_FILE__", + "errors": null, + "id": 9, + "input_connections": { + "how|labels": { + "id": 7, + "output_name": "outfile" + }, + "input": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "Relabelled strand 2", + "name": "Relabel identifiers", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 1077, + "top": 324.99999999999994 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__RELABEL_FROM_FILE__", + "tool_state": "{\"how\": {\"how_select\": \"txt\", \"__current_case__\": 0, \"labels\": {\"__class__\": \"ConnectedValue\"}, \"strict\": false}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "d181b9ba-0cd3-4de6-8e82-c53a97c5ae67", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "__MERGE_COLLECTION__", + "errors": null, + "id": 10, + "input_connections": { + "inputs_0|input": { + "id": 8, + "output_name": "output" + }, + "inputs_1|input": { + "id": 9, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Merge collections", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 1360.7832000000906, + "top": 265.99999999999994 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__MERGE_COLLECTION__", + "tool_state": "{\"advanced\": {\"conflict\": {\"duplicate_options\": \"keep_first\", \"__current_case__\": 3}}, \"inputs\": [{\"__index__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "4b4b9d77-13fe-4b8a-a5af-e0857547521e", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "wig_to_bigWig", + "errors": null, + "id": 11, + "input_connections": { + "input1": { + "id": 10, + "output_name": "output" + } + }, + "inputs": [], + "label": "convert to bigwig", + "name": "Wig/BedGraph-to-bigWig", + "outputs": [ + { + "name": "out_file1", + "type": "bigwig" + } + ], + "position": { + "left": 1624.7832000000903, + "top": 317.99999999999994 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "uniquely mapped stranded coverage" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wig_to_bigWig", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.1", + "type": "tool", + "uuid": "b69eee65-c37e-4c75-8127-b78185b130db", "when": null, "workflow_outputs": [ { - "label": "both strands coverage", + "label": "stranded coverage", "output_name": "out_file1", - "uuid": "7cb20890-9301-412c-8c37-f40eb61097e6" + "uuid": "dd43e657-0116-46ad-9cc9-c12fb871988c" } ] } }, "tags": "", - "uuid": "50fd8aa0-6b8f-4dfa-9177-a8f7b174c85d" + "uuid": "139dab52-862b-4a8b-aff2-c74be6545514" }, "tool_id": null, "type": "subworkflow", - "uuid": "469681d3-a8c5-46d7-bc70-3372f37b32c4", - "when": "$(inputs.when)", - "workflow_outputs": [ - { - "label": "both strands coverage", - "output_name": "both strands coverage", - "uuid": "737f247e-38be-4ec4-a4ed-09e6c09770be" - } - ] - }, - "17": { - "annotation": "", - "content_id": "pick_value", - "errors": null, - "id": 17, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 15, - "output_name": "output_log" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 16, - "output_name": "output_log" - } - }, - "inputs": [], - "label": "Get output_log", - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "data" - } - ], - "position": { - "left": 1082, - "top": 133 - }, - "post_job_actions": { - "ChangeDatatypeActiondata_param": { - "action_arguments": { - "newtype": "txt" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "data_param" - } - }, - "tool_id": "pick_value", - "tool_state": "{\"style_cond\": {\"pick_style\": \"only\", \"__current_case__\": 3, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.1.0", - "type": "tool", - "uuid": "ef122ac5-4032-41cd-b2c6-920d8de71e50", - "when": null, - "workflow_outputs": [ - { - "label": "output_log", - "output_name": "data_param", - "uuid": "dbfb5ee1-1e99-401d-a0ff-a97ba87a2493" - } - ] - }, - "18": { - "annotation": "", - "content_id": "pick_value", - "errors": null, - "id": 18, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 15, - "output_name": "mapped-reads" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 16, - "output_name": "mapped-reads" - } - }, - "inputs": [], - "label": "Get bam", - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "data" - } - ], - "position": { - "left": 1090.4666748046875, - "top": 284.3999938964844 - }, - "post_job_actions": { - "ChangeDatatypeActiondata_param": { - "action_arguments": { - "newtype": "bam" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "data_param" - } - }, - "tool_id": "pick_value", - "tool_state": "{\"style_cond\": {\"pick_style\": \"only\", \"__current_case__\": 3, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.1.0", - "type": "tool", - "uuid": "87560480-6a09-4432-a0ac-bff27a179f0d", + "uuid": "cc127732-933e-420a-a5ae-24fed48e7e6a", "when": null, "workflow_outputs": [ { - "label": "mapped-reads", - "output_name": "data_param", - "uuid": "9aeb4b1f-b491-4963-8724-f83a14a06f22" - } - ] - }, - "19": { - "annotation": "", - "content_id": "pick_value", - "errors": null, - "id": 19, - "input_connections": { - "style_cond|type_cond|pick_from_0|value": { - "id": 15, - "output_name": "reads_per_gene from STAR" - }, - "style_cond|type_cond|pick_from_1|value": { - "id": 16, - "output_name": "reads_per_gene from STAR" - } - }, - "inputs": [], - "label": "Get reads_per_gene", - "name": "Pick parameter value", - "outputs": [ - { - "name": "data_param", - "type": "data" - } - ], - "position": { - "left": 1111, - "top": 426 - }, - "post_job_actions": { - "ChangeDatatypeActiondata_param": { - "action_arguments": { - "newtype": "tabular" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "data_param" - } - }, - "tool_id": "pick_value", - "tool_state": "{\"style_cond\": {\"pick_style\": \"only\", \"__current_case__\": 3, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.1.0", - "type": "tool", - "uuid": "2c3ccbed-e630-4efc-9584-69c556e5f6ec", - "when": null, - "workflow_outputs": [ - { - "label": "reads_per_gene from STAR", - "output_name": "data_param", - "uuid": "b09fbc91-2612-41db-877a-20d7aa7024bd" + "label": "stranded coverage", + "output_name": "stranded coverage", + "uuid": "245c268e-87fc-43a7-9d49-d18d9363b475" } ] }, - "20": { + "17": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.3", "errors": null, - "id": 20, + "id": 17, "input_connections": { "advanced_settings|library_type": { - "id": 12, + "id": 11, "output_name": "output_param_text" }, "advanced_settings|mask_file": { - "id": 7, + "id": 6, "output_name": "output" }, "bias_correction|seq_source|index": { - "id": 10, + "id": 9, "output_name": "out1" }, "input": { - "id": 18, - "output_name": "data_param" + "id": 13, + "output_name": "mapped_reads" }, "reference_annotation|reference_annotation_file": { "id": 3, "output_name": "output" }, "when": { - "id": 6, + "id": 5, "output_name": "output" } }, @@ -1926,8 +1621,8 @@ } ], "position": { - "left": 1191.433349609375, - "top": 903.916346667486 + "left": 1266.433349609375, + "top": 1002.5131353932526 }, "post_job_actions": { "HideDatasetActionassembled_isoforms": { @@ -1971,26 +1666,83 @@ } ] }, - "21": { + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "errors": null, + "id": 18, + "input_connections": { + "code": { + "id": 10, + "output_name": "output_param_text" + }, + "infile": { + "id": 13, + "output_name": "reads_per_gene" + } + }, + "inputs": [], + "label": "Extract gene counts", + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 1438.3449044140093, + "top": 809.4166412353516 + }, + "post_job_actions": { + "RenameDatasetActionoutfile": { + "action_arguments": { + "newname": "HTS count like output" + }, + "action_type": "RenameDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": {\"__class__\": \"ConnectedValue\"}, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "3b5e2b1f-bb92-4b81-8b47-12dc83f81b02", + "when": null, + "workflow_outputs": [ + { + "label": "HTS count like output", + "output_name": "outfile", + "uuid": "799d84a4-0fe4-4ecc-882b-ee007a6f2358" + } + ] + }, + "19": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/stringtie/stringtie/2.2.1+galaxy1", "errors": null, - "id": 21, + "id": 19, "input_connections": { "guide|guide_source|ref_hist": { "id": 3, "output_name": "output" }, "input_options|input_bam": { - "id": 18, - "output_name": "data_param" + "id": 13, + "output_name": "mapped_reads" }, "rna_strandness": { - "id": 13, + "id": 12, "output_name": "output_param_text" }, "when": { - "id": 8, + "id": 7, "output_name": "output" } }, @@ -2013,8 +1765,8 @@ } ], "position": { - "left": 1149.9188687452759, - "top": 1463.107508467257 + "left": 1224.9188687452759, + "top": 1561.7042971930236 }, "post_job_actions": { "HideDatasetActionoutput_gtf": { @@ -2042,140 +1794,11 @@ "uuid": "bd391675-83ab-4eac-8083-be71c69b786f" } ] - }, - "22": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", - "errors": null, - "id": 22, - "input_connections": { - "results_0|software_cond|input": { - "id": 9, - "output_name": "report" - }, - "results_1|software_cond|output_0|type|input": { - "id": 17, - "output_name": "data_param" - }, - "results_1|software_cond|output_1|type|input": { - "id": 19, - "output_name": "data_param" - } - }, - "inputs": [], - "label": "MultiQC", - "name": "MultiQC", - "outputs": [ - { - "name": "stats", - "type": "input" - }, - { - "name": "plots", - "type": "input" - }, - { - "name": "html_report", - "type": "html" - } - ], - "position": { - "left": 1385.2166748046875, - "top": 110.683349609375 - }, - "post_job_actions": { - "HideDatasetActionplots": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "plots" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", - "tool_shed_repository": { - "changeset_revision": "abfd8a6544d7", - "name": "multiqc", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"star\", \"__current_case__\": 28, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"log\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"type\": {\"type\": \"genecounts\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}], \"saveLog\": false, \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.11+galaxy1", - "type": "tool", - "uuid": "a4e1b954-a475-4a3c-b84a-5dc44947e1c8", - "when": null, - "workflow_outputs": [ - { - "label": "MultiQC on input dataset(s): Stats", - "output_name": "stats", - "uuid": "4a60ab44-4c20-40e2-8896-778ddf7c6b93" - }, - { - "label": "MultiQC webpage", - "output_name": "html_report", - "uuid": "bbdeacff-6ca5-4259-940b-3b7bd033f41c" - } - ] - }, - "23": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", - "errors": null, - "id": 23, - "input_connections": { - "code": { - "id": 11, - "output_name": "output_param_text" - }, - "infile": { - "id": 19, - "output_name": "data_param" - } - }, - "inputs": [], - "label": "Extract gene counts", - "name": "Text reformatting", - "outputs": [ - { - "name": "outfile", - "type": "input" - } - ], - "position": { - "left": 1411.3499755859375, - "top": 665.816650390625 - }, - "post_job_actions": { - "RenameDatasetActionoutfile": { - "action_arguments": { - "newname": "HTS count like output" - }, - "action_type": "RenameDatasetAction", - "output_name": "outfile" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", - "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"code\": {\"__class__\": \"ConnectedValue\"}, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.2", - "type": "tool", - "uuid": "3b5e2b1f-bb92-4b81-8b47-12dc83f81b02", - "when": null, - "workflow_outputs": [ - { - "label": "HTS count like output", - "output_name": "outfile", - "uuid": "799d84a4-0fe4-4ecc-882b-ee007a6f2358" - } - ] } }, "tags": [ "RNAseq" ], - "uuid": "8ebdc332-ed3b-4d43-8301-33da8eefb9d3", - "version": 17 + "uuid": "1097b24d-c228-4d2c-908d-4220eb5fc3e7", + "version": 5 } \ No newline at end of file