From f8a7b1d2b43518d29bdbfe8c3162bba34fbf98d7 Mon Sep 17 00:00:00 2001 From: planemo-autoupdate Date: Fri, 17 Mar 2023 07:29:43 +0000 Subject: [PATCH 01/20] Updating workflows/epigenetics/atacseq from 0.4 to 0.5 --- workflows/epigenetics/atacseq/CHANGELOG.md | 6 +++++ workflows/epigenetics/atacseq/atacseq.ga | 26 +++++++++++----------- 2 files changed, 19 insertions(+), 13 deletions(-) diff --git a/workflows/epigenetics/atacseq/CHANGELOG.md b/workflows/epigenetics/atacseq/CHANGELOG.md index 6a63ffe02..369666acd 100644 --- a/workflows/epigenetics/atacseq/CHANGELOG.md +++ b/workflows/epigenetics/atacseq/CHANGELOG.md @@ -1,5 +1,11 @@ # Changelog +## [0.5] 2023-03-17 + +### Automatic update +- `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicatesWithMateCigar/2.18.2.3` +- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0+galaxy1` + ## [0.4] 2023-01-16 ### Automatic update diff --git a/workflows/epigenetics/atacseq/atacseq.ga b/workflows/epigenetics/atacseq/atacseq.ga index ddf9f1293..ef3abf95c 100644 --- a/workflows/epigenetics/atacseq/atacseq.ga +++ b/workflows/epigenetics/atacseq/atacseq.ga @@ -10,7 +10,7 @@ ], "format-version": "0.1", "license": "MIT", - "release": "0.4", + "release": "0.5", "name": "ATACseq", "steps": { "0": { @@ -329,7 +329,7 @@ }, "7": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4", "errors": null, "id": 7, "input_connections": { @@ -371,15 +371,15 @@ "output_name": "outFile" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4", "tool_shed_repository": { - "changeset_revision": "b502c227b5e6", + "changeset_revision": "585027e65f3b", "name": "picard", "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"assume_sorted\": \"true\", \"barcode_tag\": \"\", \"comments\": [], \"duplicate_scoring_strategy\": \"SUM_OF_BASE_QUALITIES\", \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"optical_duplicate_pixel_distance\": \"100\", \"read_name_regex\": \"\", \"remove_duplicates\": \"false\", \"validation_stringency\": \"LENIENT\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.18.2.3", + "tool_version": "2.18.2.4", "type": "tool", "uuid": "d0a9998c-18a9-4579-8d33-f0897e1ceaeb", "workflow_outputs": [ @@ -479,7 +479,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2", "tool_shed_repository": { - "changeset_revision": "07e8b80f278c", + "changeset_revision": "a1a923cd89e8", "name": "bedtools", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -768,7 +768,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_slopbed/2.30.0+galaxy1", "tool_shed_repository": { - "changeset_revision": "07e8b80f278c", + "changeset_revision": "a1a923cd89e8", "name": "bedtools", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -919,7 +919,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.30.0", "tool_shed_repository": { - "changeset_revision": "a68aa6c1204a", + "changeset_revision": "a1a923cd89e8", "name": "bedtools", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -938,7 +938,7 @@ }, "17": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0+galaxy1", "errors": null, "id": 17, "input_connections": { @@ -978,15 +978,15 @@ "output_name": "output" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0+galaxy1", "tool_shed_repository": { - "changeset_revision": "a68aa6c1204a", + "changeset_revision": "a1a923cd89e8", "name": "bedtools", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"a_or_b\": \"false\", \"d\": \"false\", \"hist\": \"false\", \"inputA\": {\"__class__\": \"ConnectedValue\"}, \"overlap_a\": null, \"overlap_b\": null, \"reciprocal_overlap\": \"false\", \"reduce_or_iterate\": {\"reduce_or_iterate_selector\": \"iterate\", \"__current_case__\": 0, \"inputB\": {\"__class__\": \"ConnectedValue\"}}, \"sorted\": \"false\", \"split\": \"false\", \"strandedness\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.30.0", + "tool_state": "{\"a_or_b\": \"false\", \"d\": \"false\", \"hist\": \"false\", \"inputA\": {\"__class__\": \"ConnectedValue\"}, \"mean\": \"false\", \"overlap_a\": null, \"overlap_b\": null, \"reciprocal_overlap\": \"false\", \"reduce_or_iterate\": {\"reduce_or_iterate_selector\": \"iterate\", \"__current_case__\": 0, \"inputB\": {\"__class__\": \"ConnectedValue\"}}, \"sorted\": \"false\", \"split\": \"false\", \"strandedness\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.30.0+galaxy1", "type": "tool", "uuid": "f3681ac7-e1ba-4442-971f-8353389c5265", "workflow_outputs": [] From bbfe72ed3e9f56921a0ee1f6a26bbf374ca3dc44 Mon Sep 17 00:00:00 2001 From: planemo-autoupdate Date: Fri, 17 Mar 2023 07:32:28 +0000 Subject: [PATCH 02/20] Updating workflows/epigenetics/cutandrun from 0.3 to 0.4 --- workflows/epigenetics/cutandrun/CHANGELOG.md | 5 +++++ workflows/epigenetics/cutandrun/cutandrun.ga | 12 ++++++------ 2 files changed, 11 insertions(+), 6 deletions(-) diff --git a/workflows/epigenetics/cutandrun/CHANGELOG.md b/workflows/epigenetics/cutandrun/CHANGELOG.md index 0640e92c4..d5d4e008e 100644 --- a/workflows/epigenetics/cutandrun/CHANGELOG.md +++ b/workflows/epigenetics/cutandrun/CHANGELOG.md @@ -1,5 +1,10 @@ # Changelog +## [0.4] 2023-03-17 + +### Automatic update +- `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicatesWithMateCigar/2.18.2.3` + ## [0.3] 2022-12-17 ### Automatic update diff --git a/workflows/epigenetics/cutandrun/cutandrun.ga b/workflows/epigenetics/cutandrun/cutandrun.ga index b74ba406d..32a0ffe4c 100644 --- a/workflows/epigenetics/cutandrun/cutandrun.ga +++ b/workflows/epigenetics/cutandrun/cutandrun.ga @@ -10,7 +10,7 @@ ], "format-version": "0.1", "license": "MIT", - "release": "0.3", + "release": "0.4", "name": "CUTandRUN", "steps": { "0": { @@ -341,7 +341,7 @@ }, "8": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4", "errors": null, "id": 8, "input_connections": { @@ -383,15 +383,15 @@ "output_name": "outFile" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4", "tool_shed_repository": { - "changeset_revision": "b502c227b5e6", + "changeset_revision": "585027e65f3b", "name": "picard", "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"assume_sorted\": \"true\", \"barcode_tag\": \"\", \"comments\": [], \"duplicate_scoring_strategy\": \"SUM_OF_BASE_QUALITIES\", \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"optical_duplicate_pixel_distance\": \"100\", \"read_name_regex\": \"\", \"remove_duplicates\": \"false\", \"validation_stringency\": \"LENIENT\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.18.2.3", + "tool_version": "2.18.2.4", "type": "tool", "uuid": "7f78ad5a-5250-4ced-aa7f-cf0802051c82", "workflow_outputs": [ @@ -447,7 +447,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2", "tool_shed_repository": { - "changeset_revision": "07e8b80f278c", + "changeset_revision": "a1a923cd89e8", "name": "bedtools", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" From 8cb7e736c6ae9a72fec0bae0ea916f5eaa50829f Mon Sep 17 00:00:00 2001 From: planemo-autoupdate Date: Sat, 17 Jun 2023 07:26:43 +0000 Subject: [PATCH 03/20] Updating workflows/epigenetics/atacseq from 0.5 to 0.6 --- workflows/epigenetics/atacseq/atacseq.ga | 52 +++++++++++++++++------- 1 file changed, 37 insertions(+), 15 deletions(-) diff --git a/workflows/epigenetics/atacseq/atacseq.ga b/workflows/epigenetics/atacseq/atacseq.ga index ef3abf95c..731cfb15c 100644 --- a/workflows/epigenetics/atacseq/atacseq.ga +++ b/workflows/epigenetics/atacseq/atacseq.ga @@ -10,7 +10,7 @@ ], "format-version": "0.1", "license": "MIT", - "release": "0.5", + "release": "0.6", "name": "ATACseq", "steps": { "0": { @@ -37,6 +37,7 @@ "tool_version": null, "type": "data_collection_input", "uuid": "3b1d869d-e8a9-49d9-894c-8aa500cd445d", + "when": null, "workflow_outputs": [] }, "1": { @@ -63,6 +64,7 @@ "tool_version": null, "type": "parameter_input", "uuid": "c085055c-9d18-49d7-9f87-fae61683d775", + "when": null, "workflow_outputs": [] }, "2": { @@ -89,11 +91,12 @@ "tool_version": null, "type": "parameter_input", "uuid": "43f5c231-ed56-4cda-bd50-0495dfd77d70", + "when": null, "workflow_outputs": [] }, "3": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "errors": null, "id": 3, "input_connections": { @@ -138,17 +141,18 @@ "output_name": "report" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "135b80fb1ac2", + "changeset_revision": "8c0175e03cee", "name": "cutadapt", "owner": "lparsons", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": \"false\", \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": \" \", \"revcomp\": \"false\"}, \"filter_options\": {\"discard_trimmed\": \"false\", \"discard_untrimmed\": \"false\", \"minimum_length\": \"15\", \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": \"false\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Nextera R1\", \"adapter\": \"CTGTCTCTTATACACATCTCCGAGCCCACGAGAC\"}, \"single_noindels\": \"false\"}], \"front_adapters\": [], \"anywhere_adapters\": [], \"cut\": \"0\"}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source2\": {\"adapter_source_list2\": \"user\", \"__current_case__\": 0, \"adapter_name2\": \"Nextera R2\", \"adapter2\": \"CTGTCTCTTATACACATCTGACGCTGCCGACGA\"}, \"single_noindels\": \"false\"}], \"front_adapters2\": [], \"anywhere_adapters2\": [], \"cut2\": \"0\", \"quality_cutoff2\": \"\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": \"false\", \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": \"false\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "4.0+galaxy1", + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": \" \", \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Nextera R1\", \"adapter\": \"CTGTCTCTTATACACATCTCCGAGCCCACGAGAC\"}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": [], \"cut\": \"0\"}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source2\": {\"adapter_source_list2\": \"user\", \"__current_case__\": 0, \"adapter_name2\": \"Nextera R2\", \"adapter2\": \"CTGTCTCTTATACACATCTGACGCTGCCGACGA\"}, \"single_noindels\": false}], \"front_adapters2\": [], \"anywhere_adapters2\": [], \"cut2\": \"0\", \"quality_cutoff2\": \"\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "4.4+galaxy0", "type": "tool", "uuid": "33fa2759-9f3f-431b-b35c-b5c777d5d5b7", + "when": null, "workflow_outputs": [] }, "4": { @@ -211,10 +215,11 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"--very-sensitive\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": \"false\", \"aligned_file\": \"false\", \"paired_options\": {\"paired_options_selector\": \"no\", \"__current_case__\": 1}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"--very-sensitive\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false, \"paired_options\": {\"paired_options_selector\": \"no\", \"__current_case__\": 1}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.5.0+galaxy0", "type": "tool", "uuid": "c32a3847-f673-487f-af98-8d50999f2d21", + "when": null, "workflow_outputs": [ { "label": "mapping stats", @@ -277,10 +282,11 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"conditions\": [{\"__index__\": 0, \"filters\": [{\"__index__\": 0, \"bam_property\": {\"bam_property_selector\": \"mapQuality\", \"__current_case__\": 14, \"bam_property_value\": \">=30\"}}, {\"__index__\": 1, \"bam_property\": {\"bam_property_selector\": \"isProperPair\", \"__current_case__\": 11, \"bam_property_value\": \"true\"}}, {\"__index__\": 2, \"bam_property\": {\"bam_property_selector\": \"reference\", \"__current_case__\": 20, \"bam_property_value\": \"!chrM\"}}, {\"__index__\": 3, \"bam_property\": {\"bam_property_selector\": \"mateReference\", \"__current_case__\": 16, \"bam_property_value\": \"!MT\"}}]}], \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"rule_configuration\": {\"rules_selector\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"conditions\": [{\"__index__\": 0, \"filters\": [{\"__index__\": 0, \"bam_property\": {\"bam_property_selector\": \"mapQuality\", \"__current_case__\": 14, \"bam_property_value\": \">=30\"}}, {\"__index__\": 1, \"bam_property\": {\"bam_property_selector\": \"isProperPair\", \"__current_case__\": 11, \"bam_property_value\": true}}, {\"__index__\": 2, \"bam_property\": {\"bam_property_selector\": \"reference\", \"__current_case__\": 20, \"bam_property_value\": \"!chrM\"}}, {\"__index__\": 3, \"bam_property\": {\"bam_property_selector\": \"mateReference\", \"__current_case__\": 16, \"bam_property_value\": \"!MT\"}}]}], \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"rule_configuration\": {\"rules_selector\": false, \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.5.2+galaxy1", "type": "tool", "uuid": "eba4c413-30c9-4bab-a088-dc12d5956c91", + "when": null, "workflow_outputs": [] }, "6": { @@ -325,6 +331,7 @@ "tool_version": "2.0.4", "type": "tool", "uuid": "024f7338-2712-4fb1-a913-dfd5bc2d4f1e", + "when": null, "workflow_outputs": [] }, "7": { @@ -378,10 +385,11 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"assume_sorted\": \"true\", \"barcode_tag\": \"\", \"comments\": [], \"duplicate_scoring_strategy\": \"SUM_OF_BASE_QUALITIES\", \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"optical_duplicate_pixel_distance\": \"100\", \"read_name_regex\": \"\", \"remove_duplicates\": \"false\", \"validation_stringency\": \"LENIENT\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"assume_sorted\": true, \"barcode_tag\": \"\", \"comments\": [], \"duplicate_scoring_strategy\": \"SUM_OF_BASE_QUALITIES\", \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"optical_duplicate_pixel_distance\": \"100\", \"read_name_regex\": \"\", \"remove_duplicates\": false, \"validation_stringency\": \"LENIENT\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.18.2.4", "type": "tool", "uuid": "d0a9998c-18a9-4579-8d33-f0897e1ceaeb", + "when": null, "workflow_outputs": [ { "label": "MarkDuplicates metrics", @@ -437,6 +445,7 @@ "tool_version": "1.1.2", "type": "tool", "uuid": "9ae38aa6-511d-4ab4-b055-7a1dae65649f", + "when": null, "workflow_outputs": [] }, "9": { @@ -484,10 +493,11 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"ed_score\": \"false\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"split\": \"false\", \"tag\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"ed_score\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"split\": false, \"tag\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.30.0+galaxy2", "type": "tool", "uuid": "12ca18f2-222b-4e9c-8ae0-b5772cd51bd7", + "when": null, "workflow_outputs": [] }, "10": { @@ -543,6 +553,7 @@ "tool_version": "1.0.1", "type": "tool", "uuid": "cc486ad2-0f48-4636-98b5-ea5fad9b75b3", + "when": null, "workflow_outputs": [ { "label": "histogram of fragment length", @@ -593,6 +604,7 @@ "tool_version": "1.15.1+galaxy0", "type": "tool", "uuid": "2999f836-c74f-47ed-b1ad-81f43349fe11", + "when": null, "workflow_outputs": [] }, "12": { @@ -712,10 +724,11 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"advanced_options\": {\"to_large\": \"false\", \"nolambda\": \"false\", \"spmr\": \"false\", \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": \"true\"}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"all\", \"__current_case__\": 2}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BED\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"-100\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": false, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"all\", \"__current_case__\": 2}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BED\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"-100\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.2.7.1+galaxy0", "type": "tool", "uuid": "57386f5d-96bb-4684-97dc-3b2228189c01", + "when": null, "workflow_outputs": [ { "label": "MACS2 narrowPeak", @@ -773,10 +786,11 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"addition\": {\"addition_select\": \"b\", \"__current_case__\": 0, \"b\": \"500\"}, \"genome_file_opts\": {\"genome_file_opts_selector\": \"loc\", \"__current_case__\": 0, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"header\": \"false\", \"inputA\": {\"__class__\": \"ConnectedValue\"}, \"pct\": \"false\", \"strand\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"addition\": {\"addition_select\": \"b\", \"__current_case__\": 0, \"b\": \"500\"}, \"genome_file_opts\": {\"genome_file_opts_selector\": \"loc\", \"__current_case__\": 0, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"header\": false, \"inputA\": {\"__class__\": \"ConnectedValue\"}, \"pct\": false, \"strand\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.30.0+galaxy1", "type": "tool", "uuid": "d1c672ca-ee55-4e48-9d97-75552050534a", + "when": null, "workflow_outputs": [] }, "14": { @@ -830,6 +844,7 @@ "tool_version": "1.1.1", "type": "tool", "uuid": "a12ee458-2fe0-4d1e-8df9-c8fc76d7b277", + "when": null, "workflow_outputs": [ { "label": "MACS2 report", @@ -876,6 +891,7 @@ "tool_version": "1.1.1", "type": "tool", "uuid": "c2c4f5aa-1b0d-4801-bc23-8ebdaa3ac176", + "when": null, "workflow_outputs": [ { "label": "Coverage from MACS2 (bigwig)", @@ -924,10 +940,11 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"c_and_o_argument_repeat\": [], \"distance\": \"0\", \"header\": \"false\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"strand\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"c_and_o_argument_repeat\": [], \"distance\": \"0\", \"header\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"strand\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.30.0", "type": "tool", "uuid": "a74b6905-51b8-4c39-bc8c-3267b1f0a7a5", + "when": null, "workflow_outputs": [ { "label": "1kb around summits", @@ -985,10 +1002,11 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"a_or_b\": \"false\", \"d\": \"false\", \"hist\": \"false\", \"inputA\": {\"__class__\": \"ConnectedValue\"}, \"mean\": \"false\", \"overlap_a\": null, \"overlap_b\": null, \"reciprocal_overlap\": \"false\", \"reduce_or_iterate\": {\"reduce_or_iterate_selector\": \"iterate\", \"__current_case__\": 0, \"inputB\": {\"__class__\": \"ConnectedValue\"}}, \"sorted\": \"false\", \"split\": \"false\", \"strandedness\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"a_or_b\": false, \"d\": false, \"hist\": false, \"inputA\": {\"__class__\": \"ConnectedValue\"}, \"mean\": false, \"overlap_a\": null, \"overlap_b\": null, \"reciprocal_overlap\": false, \"reduce_or_iterate\": {\"reduce_or_iterate_selector\": \"iterate\", \"__current_case__\": 0, \"inputB\": {\"__class__\": \"ConnectedValue\"}}, \"sorted\": false, \"split\": false, \"strandedness\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.30.0+galaxy1", "type": "tool", "uuid": "f3681ac7-e1ba-4442-971f-8353389c5265", + "when": null, "workflow_outputs": [] }, "18": { @@ -1042,6 +1060,7 @@ "tool_version": "1.1.2", "type": "tool", "uuid": "f65b3936-595c-4ddb-88bc-2cc41e514e38", + "when": null, "workflow_outputs": [ { "label": "Nb of reads in summits +-500bp", @@ -1090,6 +1109,7 @@ "tool_version": "1.0.0", "type": "tool", "uuid": "ae286273-3247-4a8f-b296-33a679fbaf7d", + "when": null, "workflow_outputs": [] }, "20": { @@ -1134,6 +1154,7 @@ "tool_version": "1.1.2", "type": "tool", "uuid": "7fe2bb35-31b5-4da0-83cf-38bb4af2848e", + "when": null, "workflow_outputs": [] }, "21": { @@ -1206,10 +1227,11 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"comment\": \"\", \"export\": \"true\", \"flat\": \"false\", \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"bowtie2\", \"__current_case__\": 3, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"custom_content\", \"__current_case__\": 32, \"plot_type\": \"bargraph\", \"section_name\": \"chrM\", \"title\": \"reads mapping on chrM\", \"description\": \"\", \"xlab\": \"\", \"ylab\": \"\", \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 3, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 17, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 4, \"software_cond\": {\"software\": \"custom_content\", \"__current_case__\": 32, \"plot_type\": \"linegraph\", \"section_name\": \"Fragment size\", \"title\": \"Fragment size distribution\", \"description\": \"\", \"xlab\": \"\", \"ylab\": \"\", \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 5, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 6, \"software_cond\": {\"software\": \"custom_content\", \"__current_case__\": 32, \"plot_type\": \"bargraph\", \"section_name\": \"Reads in peaks\", \"title\": \"Number of reads in peaks\", \"description\": \"Number of reads falling 500bp from a summit\", \"xlab\": \"\", \"ylab\": \"\", \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": \"false\", \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"bowtie2\", \"__current_case__\": 3, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"custom_content\", \"__current_case__\": 32, \"plot_type\": \"bargraph\", \"section_name\": \"chrM\", \"title\": \"reads mapping on chrM\", \"description\": \"\", \"xlab\": \"\", \"ylab\": \"\", \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 3, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 17, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 4, \"software_cond\": {\"software\": \"custom_content\", \"__current_case__\": 32, \"plot_type\": \"linegraph\", \"section_name\": \"Fragment size\", \"title\": \"Fragment size distribution\", \"description\": \"\", \"xlab\": \"\", \"ylab\": \"\", \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 5, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 6, \"software_cond\": {\"software\": \"custom_content\", \"__current_case__\": 32, \"plot_type\": \"bargraph\", \"section_name\": \"Reads in peaks\", \"title\": \"Number of reads in peaks\", \"description\": \"Number of reads falling 500bp from a summit\", \"xlab\": \"\", \"ylab\": \"\", \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": false, \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "1.11+galaxy1", "type": "tool", "uuid": "112d720f-c747-4c92-985f-ebdb52086cc9", + "when": null, "workflow_outputs": [ { "label": "MultiQC on input dataset(s): Stats", From d2aa61428a646e2d3d403365c763a47df1b635e7 Mon Sep 17 00:00:00 2001 From: planemo-autoupdate Date: Sat, 17 Jun 2023 07:28:28 +0000 Subject: [PATCH 04/20] Updating workflows/epigenetics/chipseq-pe from 0.3 to 0.4 --- workflows/epigenetics/chipseq-pe/CHANGELOG.md | 5 +++ .../epigenetics/chipseq-pe/chipseq-pe.ga | 32 +++++++++++++------ 2 files changed, 27 insertions(+), 10 deletions(-) diff --git a/workflows/epigenetics/chipseq-pe/CHANGELOG.md b/workflows/epigenetics/chipseq-pe/CHANGELOG.md index 18ed23d48..f873564de 100644 --- a/workflows/epigenetics/chipseq-pe/CHANGELOG.md +++ b/workflows/epigenetics/chipseq-pe/CHANGELOG.md @@ -1,5 +1,10 @@ # Changelog +## [0.4] 2023-06-17 + +### Automatic update +- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0` + ## [0.3] 2022-12-17 ### Automatic update diff --git a/workflows/epigenetics/chipseq-pe/chipseq-pe.ga b/workflows/epigenetics/chipseq-pe/chipseq-pe.ga index 4b9a5c0ce..96df1313c 100644 --- a/workflows/epigenetics/chipseq-pe/chipseq-pe.ga +++ b/workflows/epigenetics/chipseq-pe/chipseq-pe.ga @@ -10,7 +10,7 @@ ], "format-version": "0.1", "license": "MIT", - "release": "0.3", + "release": "0.4", "name": "ChIPseq_PE", "steps": { "0": { @@ -37,6 +37,7 @@ "tool_version": null, "type": "data_collection_input", "uuid": "e09c0852-1db3-4a68-b88c-1b94c205cb6c", + "when": null, "workflow_outputs": [] }, "1": { @@ -63,6 +64,7 @@ "tool_version": null, "type": "parameter_input", "uuid": "30c1d867-5e73-4348-8969-848f58d94015", + "when": null, "workflow_outputs": [] }, "2": { @@ -89,6 +91,7 @@ "tool_version": null, "type": "parameter_input", "uuid": "ec244ede-8fa3-4d05-85a0-06839f4cf97d", + "when": null, "workflow_outputs": [] }, "3": { @@ -115,6 +118,7 @@ "tool_version": null, "type": "parameter_input", "uuid": "0119d669-7ce9-46fd-ba6f-3efd92dfb7f2", + "when": null, "workflow_outputs": [] }, "4": { @@ -141,11 +145,12 @@ "tool_version": null, "type": "parameter_input", "uuid": "5bb3b3df-60ab-4ec7-88e4-476be547ffbf", + "when": null, "workflow_outputs": [] }, "5": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "errors": null, "id": 5, "input_connections": { @@ -198,17 +203,18 @@ "output_name": "report" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "135b80fb1ac2", + "changeset_revision": "8c0175e03cee", "name": "cutadapt", "owner": "lparsons", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": \"false\", \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": \" \", \"revcomp\": \"false\"}, \"filter_options\": {\"discard_trimmed\": \"false\", \"discard_untrimmed\": \"false\", \"minimum_length\": \"15\", \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": \"false\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": \"false\"}], \"front_adapters\": [], \"anywhere_adapters\": [], \"cut\": \"0\"}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source2\": {\"adapter_source_list2\": \"user\", \"__current_case__\": 0, \"adapter_name2\": \"Please use: For R2: - For Nextera: CTGTCTCTTATACACATCTGACGCTGCCGACGA - For TruSeq: GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT\", \"adapter2\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": \"false\"}], \"front_adapters2\": [], \"anywhere_adapters2\": [], \"cut2\": \"0\", \"quality_cutoff2\": \"\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": \"false\", \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": \"false\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "4.0+galaxy1", + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": \" \", \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": [], \"cut\": \"0\"}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source2\": {\"adapter_source_list2\": \"user\", \"__current_case__\": 0, \"adapter_name2\": \"Please use: For R2: - For Nextera: CTGTCTCTTATACACATCTGACGCTGCCGACGA - For TruSeq: GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT\", \"adapter2\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters2\": [], \"anywhere_adapters2\": [], \"cut2\": \"0\", \"quality_cutoff2\": \"\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "4.4+galaxy0", "type": "tool", "uuid": "c7846b4c-54fb-458e-982e-c0d8358a9f5d", + "when": null, "workflow_outputs": [] }, "6": { @@ -271,10 +277,11 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"no_presets\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": \"false\", \"aligned_file\": \"false\", \"paired_options\": {\"paired_options_selector\": \"no\", \"__current_case__\": 1}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"no_presets\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false, \"paired_options\": {\"paired_options_selector\": \"no\", \"__current_case__\": 1}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.5.0+galaxy0", "type": "tool", "uuid": "6fd8444b-f305-4daa-a33a-5cb44e063f39", + "when": null, "workflow_outputs": [ { "label": "mapping stats", @@ -328,10 +335,11 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"flag\": {\"filter\": \"yes\", \"__current_case__\": 1, \"reqBits\": [\"0x0002\"], \"skipBits\": null}, \"header\": \"-h\", \"input1\": {\"__class__\": \"ConnectedValue\"}, \"library\": \"\", \"mapq\": \"30\", \"outputtype\": \"bam\", \"possibly_select_inverse\": \"false\", \"read_group\": \"\", \"regions\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"flag\": {\"filter\": \"yes\", \"__current_case__\": 1, \"reqBits\": [\"0x0002\"], \"skipBits\": null}, \"header\": \"-h\", \"input1\": {\"__class__\": \"ConnectedValue\"}, \"library\": \"\", \"mapq\": \"30\", \"outputtype\": \"bam\", \"possibly_select_inverse\": false, \"read_group\": \"\", \"regions\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "1.8+galaxy1", "type": "tool", "uuid": "bb6e3ac5-cdb0-493c-b534-264ba530a711", + "when": null, "workflow_outputs": [ { "label": "filtered BAM", @@ -447,10 +455,11 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"advanced_options\": {\"to_large\": \"false\", \"nolambda\": \"false\", \"spmr\": \"false\", \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": \"true\"}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"1\", \"__current_case__\": 1}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BAMPE\", \"nomodel_type\": {\"nomodel_type_selector\": \"create_model\", \"__current_case__\": 0, \"mfold_lower\": \"5\", \"mfold_upper\": \"50\", \"band_width\": \"300\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": false, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"1\", \"__current_case__\": 1}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BAMPE\", \"nomodel_type\": {\"nomodel_type_selector\": \"create_model\", \"__current_case__\": 0, \"mfold_lower\": \"5\", \"mfold_upper\": \"50\", \"band_width\": \"300\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.2.7.1+galaxy0", "type": "tool", "uuid": "06ca906e-c512-4376-9ffc-8eb2b5774af1", + "when": null, "workflow_outputs": [ { "label": "MACS2 summits", @@ -520,6 +529,7 @@ "tool_version": "1.1.1", "type": "tool", "uuid": "95832fa1-e96e-4867-8162-d1e39cb1dc46", + "when": null, "workflow_outputs": [ { "label": "MACS2 report", @@ -566,6 +576,7 @@ "tool_version": "1.1.1", "type": "tool", "uuid": "0fe57c5d-00a0-4cb6-9bac-97e6d03c6b76", + "when": null, "workflow_outputs": [ { "label": "coverage from MACS2", @@ -628,10 +639,11 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"comment\": \"\", \"export\": \"true\", \"flat\": \"false\", \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"bowtie2\", \"__current_case__\": 3, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": \"false\", \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"bowtie2\", \"__current_case__\": 3, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": false, \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "1.11+galaxy1", "type": "tool", "uuid": "fb066848-43df-412a-9767-9613bac7d961", + "when": null, "workflow_outputs": [ { "label": "MultiQC on input dataset(s): Stats", From 79658ae534cfd401e26590db6131dfdf5cc418fe Mon Sep 17 00:00:00 2001 From: planemo-autoupdate Date: Sat, 17 Jun 2023 07:30:11 +0000 Subject: [PATCH 05/20] Updating workflows/epigenetics/chipseq-sr from 0.3 to 0.4 --- workflows/epigenetics/chipseq-sr/CHANGELOG.md | 5 +++ .../epigenetics/chipseq-sr/chipseq-sr.ga | 31 +++++++++++++------ 2 files changed, 26 insertions(+), 10 deletions(-) diff --git a/workflows/epigenetics/chipseq-sr/CHANGELOG.md b/workflows/epigenetics/chipseq-sr/CHANGELOG.md index 1c7cdf584..47612b8cc 100644 --- a/workflows/epigenetics/chipseq-sr/CHANGELOG.md +++ b/workflows/epigenetics/chipseq-sr/CHANGELOG.md @@ -1,5 +1,10 @@ # Changelog +## [0.4] 2023-06-17 + +### Automatic update +- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0` + ## [0.3] 2022-12-17 ### Automatic update diff --git a/workflows/epigenetics/chipseq-sr/chipseq-sr.ga b/workflows/epigenetics/chipseq-sr/chipseq-sr.ga index 8c81835c4..925eb635e 100644 --- a/workflows/epigenetics/chipseq-sr/chipseq-sr.ga +++ b/workflows/epigenetics/chipseq-sr/chipseq-sr.ga @@ -10,7 +10,7 @@ ], "format-version": "0.1", "license": "MIT", - "release": "0.3", + "release": "0.4", "name": "ChIPseq_SR", "steps": { "0": { @@ -37,6 +37,7 @@ "tool_version": null, "type": "data_collection_input", "uuid": "e09c0852-1db3-4a68-b88c-1b94c205cb6c", + "when": null, "workflow_outputs": [] }, "1": { @@ -63,6 +64,7 @@ "tool_version": null, "type": "parameter_input", "uuid": "30c1d867-5e73-4348-8969-848f58d94015", + "when": null, "workflow_outputs": [] }, "2": { @@ -89,6 +91,7 @@ "tool_version": null, "type": "parameter_input", "uuid": "0119d669-7ce9-46fd-ba6f-3efd92dfb7f2", + "when": null, "workflow_outputs": [] }, "3": { @@ -115,11 +118,12 @@ "tool_version": null, "type": "parameter_input", "uuid": "5bb3b3df-60ab-4ec7-88e4-476be547ffbf", + "when": null, "workflow_outputs": [] }, "4": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "errors": null, "id": 4, "input_connections": { @@ -168,17 +172,18 @@ "output_name": "report" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "135b80fb1ac2", + "changeset_revision": "8c0175e03cee", "name": "cutadapt", "owner": "lparsons", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": \"false\", \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": \" \", \"revcomp\": \"false\"}, \"filter_options\": {\"discard_trimmed\": \"false\", \"discard_untrimmed\": \"false\", \"minimum_length\": \"15\", \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": \"false\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": \"false\"}], \"front_adapters\": [], \"anywhere_adapters\": [], \"cut\": \"0\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": \"false\", \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": \"false\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "4.0+galaxy1", + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": \" \", \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": [], \"cut\": \"0\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "4.4+galaxy0", "type": "tool", "uuid": "c7846b4c-54fb-458e-982e-c0d8358a9f5d", + "when": null, "workflow_outputs": [] }, "5": { @@ -241,10 +246,11 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"no_presets\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": \"false\", \"aligned_file\": \"false\"}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"no_presets\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.5.0+galaxy0", "type": "tool", "uuid": "6fd8444b-f305-4daa-a33a-5cb44e063f39", + "when": null, "workflow_outputs": [ { "label": "mapping stats", @@ -298,10 +304,11 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"flag\": {\"filter\": \"no\", \"__current_case__\": 0}, \"header\": \"-h\", \"input1\": {\"__class__\": \"ConnectedValue\"}, \"library\": \"\", \"mapq\": \"30\", \"outputtype\": \"bam\", \"possibly_select_inverse\": \"false\", \"read_group\": \"\", \"regions\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"flag\": {\"filter\": \"no\", \"__current_case__\": 0}, \"header\": \"-h\", \"input1\": {\"__class__\": \"ConnectedValue\"}, \"library\": \"\", \"mapq\": \"30\", \"outputtype\": \"bam\", \"possibly_select_inverse\": false, \"read_group\": \"\", \"regions\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "1.8+galaxy1", "type": "tool", "uuid": "bb6e3ac5-cdb0-493c-b534-264ba530a711", + "when": null, "workflow_outputs": [ { "label": "filtered BAM", @@ -417,10 +424,11 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"advanced_options\": {\"to_large\": \"false\", \"nolambda\": \"false\", \"spmr\": \"false\", \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": \"true\"}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"1\", \"__current_case__\": 1}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BAM\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"0\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": false, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"1\", \"__current_case__\": 1}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BAM\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"0\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.2.7.1+galaxy0", "type": "tool", "uuid": "06ca906e-c512-4376-9ffc-8eb2b5774af1", + "when": null, "workflow_outputs": [ { "label": "MACS2 peaks", @@ -490,6 +498,7 @@ "tool_version": "1.1.1", "type": "tool", "uuid": "95832fa1-e96e-4867-8162-d1e39cb1dc46", + "when": null, "workflow_outputs": [ { "label": "MACS2 report", @@ -536,6 +545,7 @@ "tool_version": "1.1.1", "type": "tool", "uuid": "0fe57c5d-00a0-4cb6-9bac-97e6d03c6b76", + "when": null, "workflow_outputs": [ { "label": "coverage from MACS2", @@ -598,10 +608,11 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"comment\": \"\", \"export\": \"true\", \"flat\": \"false\", \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"bowtie2\", \"__current_case__\": 3, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": \"false\", \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"bowtie2\", \"__current_case__\": 3, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": false, \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "1.11+galaxy1", "type": "tool", "uuid": "fb066848-43df-412a-9767-9613bac7d961", + "when": null, "workflow_outputs": [ { "label": "MultiQC on input dataset(s): Stats", From 19f11175a90d9438d24ffdcba70ef9af81d3b0ad Mon Sep 17 00:00:00 2001 From: planemo-autoupdate Date: Sat, 17 Jun 2023 07:32:17 +0000 Subject: [PATCH 06/20] Updating workflows/epigenetics/cutandrun from 0.4 to 0.5 --- workflows/epigenetics/cutandrun/cutandrun.ga | 38 +++++++++++++------- 1 file changed, 26 insertions(+), 12 deletions(-) diff --git a/workflows/epigenetics/cutandrun/cutandrun.ga b/workflows/epigenetics/cutandrun/cutandrun.ga index 32a0ffe4c..e057bfba3 100644 --- a/workflows/epigenetics/cutandrun/cutandrun.ga +++ b/workflows/epigenetics/cutandrun/cutandrun.ga @@ -10,7 +10,7 @@ ], "format-version": "0.1", "license": "MIT", - "release": "0.4", + "release": "0.5", "name": "CUTandRUN", "steps": { "0": { @@ -37,6 +37,7 @@ "tool_version": null, "type": "data_collection_input", "uuid": "9fbb875d-05b1-4557-bd2e-710f80dd1a21", + "when": null, "workflow_outputs": [] }, "1": { @@ -63,6 +64,7 @@ "tool_version": null, "type": "parameter_input", "uuid": "1eac70a4-a4b7-42c7-82cd-913f23b4f941", + "when": null, "workflow_outputs": [] }, "2": { @@ -89,6 +91,7 @@ "tool_version": null, "type": "parameter_input", "uuid": "68b198e5-7de8-445f-807f-7f432090e2c7", + "when": null, "workflow_outputs": [] }, "3": { @@ -115,6 +118,7 @@ "tool_version": null, "type": "parameter_input", "uuid": "7f16a988-8ead-4a4a-9be1-8f5fbb744dec", + "when": null, "workflow_outputs": [] }, "4": { @@ -141,11 +145,12 @@ "tool_version": null, "type": "parameter_input", "uuid": "aae90433-355d-4f27-bdfb-77f8bc4fcff5", + "when": null, "workflow_outputs": [] }, "5": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "errors": null, "id": 5, "input_connections": { @@ -198,17 +203,18 @@ "output_name": "report" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "135b80fb1ac2", + "changeset_revision": "8c0175e03cee", "name": "cutadapt", "owner": "lparsons", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": \"false\", \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": \" \", \"revcomp\": \"false\"}, \"filter_options\": {\"discard_trimmed\": \"false\", \"discard_untrimmed\": \"false\", \"minimum_length\": \"15\", \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": \"false\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For TrueSeq (CUT and RUN): GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC \", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": \"false\"}], \"front_adapters\": [], \"anywhere_adapters\": [], \"cut\": \"0\"}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source2\": {\"adapter_source_list2\": \"user\", \"__current_case__\": 0, \"adapter_name2\": \"Please use: For R2: - For TruSeq (CUT and RUN): GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTGACGCTGCCGACGA\", \"adapter2\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": \"false\"}], \"front_adapters2\": [], \"anywhere_adapters2\": [], \"cut2\": \"0\", \"quality_cutoff2\": \"\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": \"false\", \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": \"false\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "4.0+galaxy1", + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": \" \", \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For TrueSeq (CUT and RUN): GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC \", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": [], \"cut\": \"0\"}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source2\": {\"adapter_source_list2\": \"user\", \"__current_case__\": 0, \"adapter_name2\": \"Please use: For R2: - For TruSeq (CUT and RUN): GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTGACGCTGCCGACGA\", \"adapter2\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters2\": [], \"anywhere_adapters2\": [], \"cut2\": \"0\", \"quality_cutoff2\": \"\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "4.4+galaxy0", "type": "tool", "uuid": "774b0604-628f-46a1-9088-a59d082e5317", + "when": null, "workflow_outputs": [] }, "6": { @@ -271,10 +277,11 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"--very-sensitive\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": \"false\", \"aligned_file\": \"false\", \"paired_options\": {\"paired_options_selector\": \"yes\", \"__current_case__\": 0, \"I\": \"0\", \"X\": \"1000\", \"fr_rf_ff\": \"--fr\", \"no_mixed\": \"false\", \"no_discordant\": \"false\", \"dovetail\": \"true\", \"no_contain\": \"false\", \"no_overlap\": \"false\"}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"--very-sensitive\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false, \"paired_options\": {\"paired_options_selector\": \"yes\", \"__current_case__\": 0, \"I\": \"0\", \"X\": \"1000\", \"fr_rf_ff\": \"--fr\", \"no_mixed\": false, \"no_discordant\": false, \"dovetail\": true, \"no_contain\": false, \"no_overlap\": false}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.5.0+galaxy0", "type": "tool", "uuid": "407d46cc-d908-44eb-a4dd-125537498b17", + "when": null, "workflow_outputs": [ { "label": "Mapping stats", @@ -333,10 +340,11 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"flag\": {\"filter\": \"yes\", \"__current_case__\": 1, \"reqBits\": [\"0x0002\"], \"skipBits\": null}, \"header\": \"-h\", \"input1\": {\"__class__\": \"ConnectedValue\"}, \"library\": \"\", \"mapq\": \"30\", \"outputtype\": \"bam\", \"possibly_select_inverse\": \"false\", \"read_group\": \"\", \"regions\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"flag\": {\"filter\": \"yes\", \"__current_case__\": 1, \"reqBits\": [\"0x0002\"], \"skipBits\": null}, \"header\": \"-h\", \"input1\": {\"__class__\": \"ConnectedValue\"}, \"library\": \"\", \"mapq\": \"30\", \"outputtype\": \"bam\", \"possibly_select_inverse\": false, \"read_group\": \"\", \"regions\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "1.8+galaxy1", "type": "tool", "uuid": "b04312a6-1680-4d8e-9c70-f30f2d2be3cc", + "when": null, "workflow_outputs": [] }, "8": { @@ -390,10 +398,11 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"assume_sorted\": \"true\", \"barcode_tag\": \"\", \"comments\": [], \"duplicate_scoring_strategy\": \"SUM_OF_BASE_QUALITIES\", \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"optical_duplicate_pixel_distance\": \"100\", \"read_name_regex\": \"\", \"remove_duplicates\": \"false\", \"validation_stringency\": \"LENIENT\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"assume_sorted\": true, \"barcode_tag\": \"\", \"comments\": [], \"duplicate_scoring_strategy\": \"SUM_OF_BASE_QUALITIES\", \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"optical_duplicate_pixel_distance\": \"100\", \"read_name_regex\": \"\", \"remove_duplicates\": false, \"validation_stringency\": \"LENIENT\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.18.2.4", "type": "tool", "uuid": "7f78ad5a-5250-4ced-aa7f-cf0802051c82", + "when": null, "workflow_outputs": [ { "label": "MarkDuplicates metrics", @@ -452,10 +461,11 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"ed_score\": \"false\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"split\": \"false\", \"tag\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"ed_score\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"split\": false, \"tag\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.30.0+galaxy2", "type": "tool", "uuid": "f447290b-bd3d-403d-bc67-0765124b7a97", + "when": null, "workflow_outputs": [] }, "10": { @@ -565,10 +575,11 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"advanced_options\": {\"to_large\": \"false\", \"nolambda\": \"false\", \"spmr\": \"false\", \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": \"true\"}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"all\", \"__current_case__\": 2}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BED\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"-100\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": false, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"all\", \"__current_case__\": 2}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BED\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"-100\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.2.7.1+galaxy0", "type": "tool", "uuid": "1a6316d7-3ee1-482a-9264-77bc98090d73", + "when": null, "workflow_outputs": [ { "label": "MACS2 peaks xls", @@ -638,6 +649,7 @@ "tool_version": "1.1.1", "type": "tool", "uuid": "c3ff2b9d-d53a-40d9-8f4c-a7a2461dd7f5", + "when": null, "workflow_outputs": [ { "label": "MACS2 report", @@ -684,6 +696,7 @@ "tool_version": "1.1.1", "type": "tool", "uuid": "4bac5ae5-8119-4ced-92cc-b2281d6199ba", + "when": null, "workflow_outputs": [ { "label": "Coverage from MACS2 (bigwig)", @@ -750,10 +763,11 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"comment\": \"\", \"export\": \"true\", \"flat\": \"false\", \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"bowtie2\", \"__current_case__\": 3, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 17, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 3, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": \"false\", \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"bowtie2\", \"__current_case__\": 3, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 17, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 3, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": false, \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "1.11+galaxy1", "type": "tool", "uuid": "0edf5e04-cc38-414c-9b57-117e919c435b", + "when": null, "workflow_outputs": [ { "label": "MultiQC webpage", From 9e68d57e958d2786945f949e873e7f71358d3ec0 Mon Sep 17 00:00:00 2001 From: Lucille Delisle Date: Wed, 30 Aug 2023 07:18:16 +0200 Subject: [PATCH 07/20] New parameter to get normalized profile --- workflows/epigenetics/chipseq-pe/CHANGELOG.md | 3 + workflows/epigenetics/chipseq-pe/README.md | 4 +- .../chipseq-pe/chipseq-pe-tests.yml | 3 +- .../epigenetics/chipseq-pe/chipseq-pe.ga | 154 +++++++++++------- 4 files changed, 102 insertions(+), 62 deletions(-) diff --git a/workflows/epigenetics/chipseq-pe/CHANGELOG.md b/workflows/epigenetics/chipseq-pe/CHANGELOG.md index f873564de..7997f762f 100644 --- a/workflows/epigenetics/chipseq-pe/CHANGELOG.md +++ b/workflows/epigenetics/chipseq-pe/CHANGELOG.md @@ -5,6 +5,9 @@ ### Automatic update - `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0` +### Manual update +- New parameter to get normalized profile + ## [0.3] 2022-12-17 ### Automatic update diff --git a/workflows/epigenetics/chipseq-pe/README.md b/workflows/epigenetics/chipseq-pe/README.md index b30f5656c..b41f1805d 100644 --- a/workflows/epigenetics/chipseq-pe/README.md +++ b/workflows/epigenetics/chipseq-pe/README.md @@ -9,19 +9,19 @@ - adapters sequences: this depends on the library preparation. If you don't know, use FastQC to determine if it is Truseq or Nextera. - reference_genome: this field will be adapted to the genomes available for bowtie2. - effective_genome_size: this is used by MACS2 and may be entered manually (indications are provided for heavily used genomes). +- normalize_profile: Whether you want to have a profile normalized as Signal to Million Fragments. ## Processing - The workflow will remove illumina adapters and low quality bases and filter out any pair with mate smaller than 15bp. - The filtered reads are mapped with bowtie2 with default parameters. - The BAM is filtered to keep only MAPQ30 and concordant pairs. -- The peaks are called with MACS2 which at the same time generates a coverage file. +- The peaks are called with MACS2 which at the same time generates a coverage file (normalized or not). - The coverage is converted to bigwig. - A MultiQC is run to have an overview of the QC. ### Warning -- The coverage output is not normalized. - The filtered bam still has PCR duplicates which are removed by MACS2. ## Contribution diff --git a/workflows/epigenetics/chipseq-pe/chipseq-pe-tests.yml b/workflows/epigenetics/chipseq-pe/chipseq-pe-tests.yml index 7a6d86ba7..cb84fab46 100644 --- a/workflows/epigenetics/chipseq-pe/chipseq-pe-tests.yml +++ b/workflows/epigenetics/chipseq-pe/chipseq-pe-tests.yml @@ -20,6 +20,7 @@ adapter_reverse: 'GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT' reference_genome: 'mm10' effective_genome_size: 1870000000 + normalize_profile: false outputs: MultiQC webpage: asserts: @@ -38,7 +39,7 @@ cutadapt: asserts: has_text: - text: "4.0\t50000\t587\t550\t3693\t46307\t5100000" + text: "4.4\t50000\t587\t550\t3693\t46307\t5100000" general_stats: asserts: has_text: diff --git a/workflows/epigenetics/chipseq-pe/chipseq-pe.ga b/workflows/epigenetics/chipseq-pe/chipseq-pe.ga index 96df1313c..0021eae60 100644 --- a/workflows/epigenetics/chipseq-pe/chipseq-pe.ga +++ b/workflows/epigenetics/chipseq-pe/chipseq-pe.ga @@ -56,8 +56,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 31.01666259765625, - "top": 81.5 + "left": 11.01666259765625, + "top": 93.5 }, "tool_id": null, "tool_state": "{\"parameter_type\": \"text\", \"optional\": false}", @@ -83,8 +83,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 72.066650390625, - "top": 173.4499969482422 + "left": 50.066650390625, + "top": 189.45001220703125 }, "tool_id": null, "tool_state": "{\"parameter_type\": \"text\", \"optional\": false}", @@ -110,8 +110,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 177.9000244140625, - "top": 305.23333740234375 + "left": 102.9000244140625, + "top": 333.23333740234375 }, "tool_id": null, "tool_state": "{\"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", @@ -137,8 +137,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 235.8499755859375, - "top": 399.6166687011719 + "left": 144.8499755859375, + "top": 437.61669921875 }, "tool_id": null, "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", @@ -149,10 +149,37 @@ "workflow_outputs": [] }, "5": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", + "annotation": "Whether you want to have a profile normalized as Signal to Million Fragments", + "content_id": null, "errors": null, "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "Whether you want to have a profile normalized as Signal to Million Fragments", + "name": "normalize_profile" + } + ], + "label": "normalize_profile", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 185, + "top": 542 + }, + "tool_id": null, + "tool_state": "{\"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "8180a47b-2fa4-404e-b644-1f3ec3bea980", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "errors": null, + "id": 6, "input_connections": { "library|input_1": { "id": 0, @@ -181,8 +208,8 @@ } ], "position": { - "left": 326.29998779296875, - "top": 4.25 + "left": 414.29998779296875, + "top": 57.25 }, "post_job_actions": { "HideDatasetActionout_pairs": { @@ -217,14 +244,14 @@ "when": null, "workflow_outputs": [] }, - "6": { + "7": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.0+galaxy0", "errors": null, - "id": 6, + "id": 7, "input_connections": { "library|input_1": { - "id": 5, + "id": 6, "output_name": "out_pairs" }, "reference_genome|index": { @@ -246,8 +273,8 @@ } ], "position": { - "left": 621.6000061035156, - "top": 383.93333435058594 + "left": 709.6000061035156, + "top": 436.93333435058594 }, "post_job_actions": { "HideDatasetActionoutput": { @@ -277,7 +304,7 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"no_presets\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false, \"paired_options\": {\"paired_options_selector\": \"no\", \"__current_case__\": 1}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"no_presets\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false, \"paired_options\": {\"paired_options_selector\": \"no\", \"__current_case__\": 1}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.5.0+galaxy0", "type": "tool", "uuid": "6fd8444b-f305-4daa-a33a-5cb44e063f39", @@ -290,14 +317,14 @@ } ] }, - "7": { + "8": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtool_filter2/samtool_filter2/1.8+galaxy1", "errors": null, - "id": 7, + "id": 8, "input_connections": { "input1": { - "id": 6, + "id": 7, "output_name": "output" } }, @@ -316,8 +343,8 @@ } ], "position": { - "left": 1017, - "top": 528.3833312988281 + "left": 1105, + "top": 581.3833312988281 }, "post_job_actions": { "RenameDatasetActionoutput1": { @@ -348,22 +375,31 @@ } ] }, - "8": { + "9": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.7.1+galaxy0", "errors": null, - "id": 8, + "id": 9, "input_connections": { + "advanced_options|spmr": { + "id": 5, + "output_name": "output" + }, "effective_genome_size_options|gsize": { "id": 4, "output_name": "output" }, "treatment|input_treatment_file": { - "id": 7, + "id": 8, "output_name": "output1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool MACS2 callpeak", + "name": "treatment" + } + ], "label": "Call Peaks with MACS2", "name": "MACS2 callpeak", "outputs": [ @@ -393,8 +429,8 @@ } ], "position": { - "left": 1458.183349609375, - "top": 261.96665954589844 + "left": 1546.183349609375, + "top": 314.96665954589844 }, "post_job_actions": { "HideDatasetActionoutput_control_lambda": { @@ -455,12 +491,17 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": false, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"1\", \"__current_case__\": 1}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BAMPE\", \"nomodel_type\": {\"nomodel_type_selector\": \"create_model\", \"__current_case__\": 0, \"mfold_lower\": \"5\", \"mfold_upper\": \"50\", \"band_width\": \"300\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": {\"__class__\": \"ConnectedValue\"}, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"1\", \"__current_case__\": 1}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BAMPE\", \"nomodel_type\": {\"nomodel_type_selector\": \"create_model\", \"__current_case__\": 0, \"mfold_lower\": \"5\", \"mfold_upper\": \"50\", \"band_width\": \"300\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"RuntimeValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.2.7.1+galaxy0", "type": "tool", "uuid": "06ca906e-c512-4376-9ffc-8eb2b5774af1", "when": null, "workflow_outputs": [ + { + "label": "MACS2 narrowPeak", + "output_name": "output_narrowpeaks", + "uuid": "7c28605b-1dad-401d-b057-7fad39ee032c" + }, { "label": "MACS2 summits", "output_name": "output_summits", @@ -470,22 +511,17 @@ "label": "MACS2 peaks", "output_name": "output_tabular", "uuid": "10114173-d06e-4ad1-aa62-0de5ca17b364" - }, - { - "label": "MACS2 narrowPeak", - "output_name": "output_narrowpeaks", - "uuid": "7c28605b-1dad-401d-b057-7fad39ee032c" } ] }, - "9": { + "10": { "annotation": "summary of MACS2", "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", "errors": null, - "id": 9, + "id": 10, "input_connections": { "infile": { - "id": 8, + "id": 9, "output_name": "output_tabular" } }, @@ -499,8 +535,8 @@ } ], "position": { - "left": 1868.11669921875, - "top": 132.96665954589844 + "left": 1956.11669921875, + "top": 185.96665954589844 }, "post_job_actions": { "ChangeDatatypeActionoutput": { @@ -520,7 +556,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", "tool_shed_repository": { - "changeset_revision": "d698c222f354", + "changeset_revision": "ddf54b12c295", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -538,14 +574,14 @@ } ] }, - "10": { + "11": { "annotation": "", "content_id": "wig_to_bigWig", "errors": null, - "id": 10, + "id": 11, "input_connections": { "input1": { - "id": 8, + "id": 9, "output_name": "output_treat_pileup" } }, @@ -559,8 +595,8 @@ } ], "position": { - "left": 1929.933349609375, - "top": 411.3333282470703 + "left": 2017.933349609375, + "top": 464.3333282470703 }, "post_job_actions": { "RenameDatasetActionout_file1": { @@ -585,22 +621,22 @@ } ] }, - "11": { + "12": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", "errors": null, - "id": 11, + "id": 12, "input_connections": { "results_0|software_cond|input": { - "id": 5, + "id": 6, "output_name": "report" }, "results_1|software_cond|input": { - "id": 6, + "id": 7, "output_name": "mapping_stats" }, "results_2|software_cond|input": { - "id": 8, + "id": 9, "output_name": "output_tabular" } }, @@ -622,8 +658,8 @@ } ], "position": { - "left": 1977.1666870117188, - "top": 790.3333129882812 + "left": 2065.1666870117188, + "top": 843.3333129882812 }, "post_job_actions": { "HideDatasetActionplots": { @@ -645,15 +681,15 @@ "uuid": "fb066848-43df-412a-9767-9613bac7d961", "when": null, "workflow_outputs": [ - { - "label": "MultiQC on input dataset(s): Stats", - "output_name": "stats", - "uuid": "409a12c8-c81d-4607-a7d8-3f8fe0ab8d02" - }, { "label": "MultiQC webpage", "output_name": "html_report", "uuid": "175c983c-cb66-430e-aaeb-252b9f520f3b" + }, + { + "label": "MultiQC on input dataset(s): Stats", + "output_name": "stats", + "uuid": "409a12c8-c81d-4607-a7d8-3f8fe0ab8d02" } ] } @@ -661,6 +697,6 @@ "tags": [ "ChIP" ], - "uuid": "12593cdc-9a1d-4cf3-810f-edeeee35b9d7", + "uuid": "d727eee1-db1c-4005-a315-a783a441fef5", "version": 1 } \ No newline at end of file From d81ab7229d1ac9b81ac628c8ee661390b5608ba6 Mon Sep 17 00:00:00 2001 From: Lucille Delisle Date: Wed, 30 Aug 2023 07:18:26 +0200 Subject: [PATCH 08/20] update dockstore file --- workflows/epigenetics/chipseq-pe/.dockstore.yml | 7 +++++-- 1 file changed, 5 insertions(+), 2 deletions(-) diff --git a/workflows/epigenetics/chipseq-pe/.dockstore.yml b/workflows/epigenetics/chipseq-pe/.dockstore.yml index c63f72bf4..138f3c0d4 100644 --- a/workflows/epigenetics/chipseq-pe/.dockstore.yml +++ b/workflows/epigenetics/chipseq-pe/.dockstore.yml @@ -1,8 +1,11 @@ version: 1.2 workflows: - name: main - primaryDescriptorPath: /chipseq-pe.ga - publish: true subclass: Galaxy + publish: true + primaryDescriptorPath: /chipseq-pe.ga testParameterFiles: - /chipseq-pe-tests.yml + authors: + - name: Lucille Delisle + orcid: 0000-0002-1964-4960 From 18cab166e436fe02037e00e0a2001acbc883b8d5 Mon Sep 17 00:00:00 2001 From: Lucille Delisle Date: Wed, 30 Aug 2023 07:06:40 +0200 Subject: [PATCH 09/20] New parameter to get normalized profile --- workflows/epigenetics/chipseq-sr/CHANGELOG.md | 3 + workflows/epigenetics/chipseq-sr/README.md | 4 +- .../chipseq-sr/chipseq-sr-tests.yml | 3 +- .../epigenetics/chipseq-sr/chipseq-sr.ga | 138 +++++++++++------- 4 files changed, 94 insertions(+), 54 deletions(-) diff --git a/workflows/epigenetics/chipseq-sr/CHANGELOG.md b/workflows/epigenetics/chipseq-sr/CHANGELOG.md index 47612b8cc..1fc54b322 100644 --- a/workflows/epigenetics/chipseq-sr/CHANGELOG.md +++ b/workflows/epigenetics/chipseq-sr/CHANGELOG.md @@ -5,6 +5,9 @@ ### Automatic update - `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0` +### Manual update +- New parameter to get normalized profile + ## [0.3] 2022-12-17 ### Automatic update diff --git a/workflows/epigenetics/chipseq-sr/README.md b/workflows/epigenetics/chipseq-sr/README.md index 9d97a32aa..0591c9d91 100644 --- a/workflows/epigenetics/chipseq-sr/README.md +++ b/workflows/epigenetics/chipseq-sr/README.md @@ -9,17 +9,17 @@ - adapters sequence_forward: this depends on the library preparation. If you don't know, use FastQC to determine if it is Truseq or Nextera. - reference_genome: this field will be adapted to the genomes available for bowtie2. - effective_genome_size: this is used by MACS2 and may be entered manually (indications are provided for heavily used genomes). +- normalize_profile: Whether you want to have a profile normalized as Signal to Million Reads. ## Processing - The workflow will remove illumina adapters and low quality bases and filter out any read smaller than 15bp. - The filtered reads are mapped with bowtie2 with default parameters. - The BAM is filtered to keep only MAPQ30. -- The peaks are called with MACS2 with a fixed extension of 200bp which at the same time generates a coverage file. +- The peaks are called with MACS2 with a fixed extension of 200bp which at the same time generates a coverage file (normalized or not). - The coverage is converted to bigwig. - A MultiQC is run to have an overview of the QC. ### Warning -- The coverage output is not normalized. - The filtered bam still has PCR duplicates which are removed by MACS2. diff --git a/workflows/epigenetics/chipseq-sr/chipseq-sr-tests.yml b/workflows/epigenetics/chipseq-sr/chipseq-sr-tests.yml index fbfc17cb8..a6bba08d7 100644 --- a/workflows/epigenetics/chipseq-sr/chipseq-sr-tests.yml +++ b/workflows/epigenetics/chipseq-sr/chipseq-sr-tests.yml @@ -11,6 +11,7 @@ adapter_forward: 'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC' reference_genome: 'mm10' effective_genome_size: 1870000000 + normalize_profile: false outputs: MultiQC webpage: asserts: @@ -29,7 +30,7 @@ cutadapt: asserts: has_text: - text: "4.0\t50000\t587\t749\t49251" + text: "4.4\t50000\t587\t749\t49251" general_stats: asserts: has_text: diff --git a/workflows/epigenetics/chipseq-sr/chipseq-sr.ga b/workflows/epigenetics/chipseq-sr/chipseq-sr.ga index 925eb635e..f75fc1f42 100644 --- a/workflows/epigenetics/chipseq-sr/chipseq-sr.ga +++ b/workflows/epigenetics/chipseq-sr/chipseq-sr.ga @@ -56,8 +56,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 31.033340454101562, - "top": 81.44999694824219 + "left": 39.0333251953125, + "top": 77.44999694824219 }, "tool_id": null, "tool_state": "{\"parameter_type\": \"text\", \"optional\": false}", @@ -83,8 +83,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 83.78334045410156, - "top": 189.96665954589844 + "left": 62.7833251953125, + "top": 169.9666748046875 }, "tool_id": null, "tool_state": "{\"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", @@ -110,8 +110,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 148.23333740234375, - "top": 292.3999938964844 + "left": 106.23333740234375, + "top": 262.3999938964844 }, "tool_id": null, "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", @@ -122,10 +122,37 @@ "workflow_outputs": [] }, "4": { + "annotation": "Whether you want to have a profile normalized as Signal to Million Reads", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "Whether you want to have a profile normalized as Signal to Million Reads", + "name": "normalize_profile" + } + ], + "label": "normalize_profile", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 163.95545543674132, + "top": 359.9555974960296 + }, + "tool_id": null, + "tool_state": "{\"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "b89b796d-df4f-416f-8bc4-4f1951efa449", + "when": null, + "workflow_outputs": [] + }, + "5": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "errors": null, - "id": 4, + "id": 5, "input_connections": { "library|input_1": { "id": 0, @@ -150,8 +177,8 @@ } ], "position": { - "left": 326.31666564941406, - "top": 4.1666717529296875 + "left": 423.31666564941406, + "top": 80.16667175292969 }, "post_job_actions": { "HideDatasetActionout1": { @@ -186,14 +213,14 @@ "when": null, "workflow_outputs": [] }, - "5": { + "6": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.0+galaxy0", "errors": null, - "id": 5, + "id": 6, "input_connections": { "library|input_1": { - "id": 4, + "id": 5, "output_name": "out1" }, "reference_genome|index": { @@ -215,8 +242,8 @@ } ], "position": { - "left": 621.6333312988281, - "top": 383.8500061035156 + "left": 718.6333312988281, + "top": 459.8500061035156 }, "post_job_actions": { "HideDatasetActionoutput": { @@ -246,7 +273,7 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"no_presets\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"no_presets\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.5.0+galaxy0", "type": "tool", "uuid": "6fd8444b-f305-4daa-a33a-5cb44e063f39", @@ -259,14 +286,14 @@ } ] }, - "6": { + "7": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtool_filter2/samtool_filter2/1.8+galaxy1", "errors": null, - "id": 6, + "id": 7, "input_connections": { "input1": { - "id": 5, + "id": 6, "output_name": "output" } }, @@ -285,8 +312,8 @@ } ], "position": { - "left": 1017.0499877929688, - "top": 528.2999877929688 + "left": 1114.0499877929688, + "top": 604.2999877929688 }, "post_job_actions": { "RenameDatasetActionoutput1": { @@ -317,22 +344,31 @@ } ] }, - "7": { + "8": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.7.1+galaxy0", "errors": null, - "id": 7, + "id": 8, "input_connections": { + "advanced_options|spmr": { + "id": 4, + "output_name": "output" + }, "effective_genome_size_options|gsize": { "id": 3, "output_name": "output" }, "treatment|input_treatment_file": { - "id": 6, + "id": 7, "output_name": "output1" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool MACS2 callpeak", + "name": "treatment" + } + ], "label": "Call Peaks with MACS2", "name": "MACS2 callpeak", "outputs": [ @@ -362,8 +398,8 @@ } ], "position": { - "left": 1458.199951171875, - "top": 261.98333740234375 + "left": 1555.199951171875, + "top": 337.98333740234375 }, "post_job_actions": { "HideDatasetActionoutput_control_lambda": { @@ -424,7 +460,7 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": false, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"1\", \"__current_case__\": 1}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BAM\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"0\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": {\"__class__\": \"ConnectedValue\"}, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"1\", \"__current_case__\": 1}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BAM\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"0\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"RuntimeValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.2.7.1+galaxy0", "type": "tool", "uuid": "06ca906e-c512-4376-9ffc-8eb2b5774af1", @@ -447,14 +483,14 @@ } ] }, - "8": { + "9": { "annotation": "summary of MACS2", "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", "errors": null, - "id": 8, + "id": 9, "input_connections": { "infile": { - "id": 7, + "id": 8, "output_name": "output_tabular" } }, @@ -468,8 +504,8 @@ } ], "position": { - "left": 1868.11669921875, - "top": 132.98333740234375 + "left": 1965.11669921875, + "top": 208.98333740234375 }, "post_job_actions": { "ChangeDatatypeActionoutput": { @@ -489,7 +525,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", "tool_shed_repository": { - "changeset_revision": "d698c222f354", + "changeset_revision": "ddf54b12c295", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -507,14 +543,14 @@ } ] }, - "9": { + "10": { "annotation": "", "content_id": "wig_to_bigWig", "errors": null, - "id": 9, + "id": 10, "input_connections": { "input1": { - "id": 7, + "id": 8, "output_name": "output_treat_pileup" } }, @@ -528,8 +564,8 @@ } ], "position": { - "left": 1929.9666748046875, - "top": 411.2833251953125 + "left": 2026.9666748046875, + "top": 487.2833251953125 }, "post_job_actions": { "RenameDatasetActionout_file1": { @@ -554,22 +590,22 @@ } ] }, - "10": { + "11": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", "errors": null, - "id": 10, + "id": 11, "input_connections": { "results_0|software_cond|input": { - "id": 4, + "id": 5, "output_name": "report" }, "results_1|software_cond|input": { - "id": 5, + "id": 6, "output_name": "mapping_stats" }, "results_2|software_cond|input": { - "id": 7, + "id": 8, "output_name": "output_tabular" } }, @@ -591,8 +627,8 @@ } ], "position": { - "left": 1977.183349609375, - "top": 790.2833251953125 + "left": 2074.183349609375, + "top": 866.2833251953125 }, "post_job_actions": { "HideDatasetActionplots": { @@ -614,15 +650,15 @@ "uuid": "fb066848-43df-412a-9767-9613bac7d961", "when": null, "workflow_outputs": [ - { - "label": "MultiQC on input dataset(s): Stats", - "output_name": "stats", - "uuid": "d4c3e0a7-d5b7-4307-8669-0254a3723ce0" - }, { "label": "MultiQC webpage", "output_name": "html_report", "uuid": "2167289f-6c78-479a-8d3b-95caf11d0c4e" + }, + { + "label": "MultiQC on input dataset(s): Stats", + "output_name": "stats", + "uuid": "d4c3e0a7-d5b7-4307-8669-0254a3723ce0" } ] } @@ -630,6 +666,6 @@ "tags": [ "ChIP" ], - "uuid": "af63dacf-ae85-42b6-88a4-2a15505d8fc9", + "uuid": "fe6bda9f-1fc2-4a86-bf8d-e779c79466fc", "version": 1 } \ No newline at end of file From 1767be0caaa78e9a62ea8d2d72ce6b960db5758d Mon Sep 17 00:00:00 2001 From: Lucille Delisle Date: Wed, 30 Aug 2023 07:22:58 +0200 Subject: [PATCH 10/20] update dockstore file --- workflows/epigenetics/chipseq-sr/.dockstore.yml | 7 +++++-- 1 file changed, 5 insertions(+), 2 deletions(-) diff --git a/workflows/epigenetics/chipseq-sr/.dockstore.yml b/workflows/epigenetics/chipseq-sr/.dockstore.yml index 9d0c4bb29..05b3726bf 100644 --- a/workflows/epigenetics/chipseq-sr/.dockstore.yml +++ b/workflows/epigenetics/chipseq-sr/.dockstore.yml @@ -1,8 +1,11 @@ version: 1.2 workflows: - name: main - primaryDescriptorPath: /chipseq-sr.ga - publish: true subclass: Galaxy + publish: true + primaryDescriptorPath: /chipseq-sr.ga testParameterFiles: - /chipseq-sr-tests.yml + authors: + - name: Lucille Delisle + orcid: 0000-0002-1964-4960 From fdd56761fc2801a58147c932a72fb0a4999e49dd Mon Sep 17 00:00:00 2001 From: Lucille Delisle Date: Wed, 30 Aug 2023 13:35:08 +0200 Subject: [PATCH 11/20] fix cutadapt version in content_id --- workflows/epigenetics/chipseq-pe/chipseq-pe.ga | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/workflows/epigenetics/chipseq-pe/chipseq-pe.ga b/workflows/epigenetics/chipseq-pe/chipseq-pe.ga index 0021eae60..58bd94be4 100644 --- a/workflows/epigenetics/chipseq-pe/chipseq-pe.ga +++ b/workflows/epigenetics/chipseq-pe/chipseq-pe.ga @@ -177,7 +177,7 @@ }, "6": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "errors": null, "id": 6, "input_connections": { @@ -699,4 +699,4 @@ ], "uuid": "d727eee1-db1c-4005-a315-a783a441fef5", "version": 1 -} \ No newline at end of file +} From 7dfb37ca03a31683fda4d71d7cc37343b9b07988 Mon Sep 17 00:00:00 2001 From: Lucille Delisle Date: Thu, 31 Aug 2023 07:43:20 +0200 Subject: [PATCH 12/20] use normalize in test --- workflows/epigenetics/chipseq-pe/chipseq-pe-tests.yml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/workflows/epigenetics/chipseq-pe/chipseq-pe-tests.yml b/workflows/epigenetics/chipseq-pe/chipseq-pe-tests.yml index cb84fab46..0d3f58eee 100644 --- a/workflows/epigenetics/chipseq-pe/chipseq-pe-tests.yml +++ b/workflows/epigenetics/chipseq-pe/chipseq-pe-tests.yml @@ -20,7 +20,7 @@ adapter_reverse: 'GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT' reference_genome: 'mm10' effective_genome_size: 1870000000 - normalize_profile: false + normalize_profile: true outputs: MultiQC webpage: asserts: @@ -96,7 +96,7 @@ wt_H3K4me3: asserts: has_size: - value: 527913 + value: 556477 delta: 10000 mapping stats: element_tests: From c2de83ca9a98dcc81e52591b062aa928ed34d669 Mon Sep 17 00:00:00 2001 From: Lucille Delisle Date: Thu, 31 Aug 2023 07:45:57 +0200 Subject: [PATCH 13/20] use normalize profile --- workflows/epigenetics/chipseq-sr/chipseq-sr-tests.yml | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/workflows/epigenetics/chipseq-sr/chipseq-sr-tests.yml b/workflows/epigenetics/chipseq-sr/chipseq-sr-tests.yml index a6bba08d7..8476a5399 100644 --- a/workflows/epigenetics/chipseq-sr/chipseq-sr-tests.yml +++ b/workflows/epigenetics/chipseq-sr/chipseq-sr-tests.yml @@ -11,7 +11,7 @@ adapter_forward: 'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC' reference_genome: 'mm10' effective_genome_size: 1870000000 - normalize_profile: false + normalize_profile: true outputs: MultiQC webpage: asserts: @@ -87,8 +87,8 @@ wt_H3K4me3: asserts: has_size: - value: 527913 - delta: 50000 + value: 559925 + delta: 10000 mapping stats: element_tests: wt_H3K4me3: From 34faa2f279039279ae5798b37846f3bf321824f1 Mon Sep 17 00:00:00 2001 From: Lucille Delisle Date: Thu, 31 Aug 2023 09:28:39 +0200 Subject: [PATCH 14/20] update dockstore, CHANGELOG and README --- workflows/epigenetics/atacseq/.dockstore.yml | 6 +++++- workflows/epigenetics/atacseq/CHANGELOG.md | 6 +++++- workflows/epigenetics/atacseq/README.md | 7 +++++-- 3 files changed, 15 insertions(+), 4 deletions(-) diff --git a/workflows/epigenetics/atacseq/.dockstore.yml b/workflows/epigenetics/atacseq/.dockstore.yml index 72bd2a463..f0bbe434d 100644 --- a/workflows/epigenetics/atacseq/.dockstore.yml +++ b/workflows/epigenetics/atacseq/.dockstore.yml @@ -1,7 +1,11 @@ version: 1.2 workflows: - name: main - primaryDescriptorPath: /atacseq.ga subclass: Galaxy + publish: true + primaryDescriptorPath: /atacseq.ga testParameterFiles: - /atacseq-tests.yml + authors: + - name: Lucille Delisle + orcid: 0000-0002-1964-4960 diff --git a/workflows/epigenetics/atacseq/CHANGELOG.md b/workflows/epigenetics/atacseq/CHANGELOG.md index 369666acd..c6d48234f 100644 --- a/workflows/epigenetics/atacseq/CHANGELOG.md +++ b/workflows/epigenetics/atacseq/CHANGELOG.md @@ -3,8 +3,12 @@ ## [0.5] 2023-03-17 ### Automatic update -- `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicatesWithMateCigar/2.18.2.3` +- `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4` - `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0+galaxy1` +- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0` + +### Manual update +- add normalization steps for coverage ## [0.4] 2023-01-16 diff --git a/workflows/epigenetics/atacseq/README.md b/workflows/epigenetics/atacseq/README.md index fe6c6bbc7..d43ec4efb 100644 --- a/workflows/epigenetics/atacseq/README.md +++ b/workflows/epigenetics/atacseq/README.md @@ -11,6 +11,7 @@ You can have more information about ATAC-seq analysis in the [slides](https://tr - reference_genome: this field will be adapted to the genomes available for bowtie2 and the genomes available for bedtools slopbed (dbkeys table) - effective_genome_size: this is used by macs2 and may be entered manually (indications are provided for heavily used genomes) +- bin_size: this is used when normalization of coverage is performed. Large values will allow to have smaller output files but with less resolution while small values will increase computation time and size of output files to produce more resolutive bigwigs. ## Processing @@ -21,7 +22,10 @@ You can have more information about ATAC-seq analysis in the [slides](https://tr - The BAM is converted to BED to enable macs2 to take both pairs into account. - The peaks are called with macs2 which at the same time generates a coverage file. - The coverage file is converted to bigwig -- The amount of reads 500bp from summits and the total number of reads are computed if further normalization is wanted. +- The amount of reads 500bp from summits and the total number of reads are computed. +- Two normalizations are computed: + - By million reads + - By million reads in peaks (500bp from summits) - Other QC are performed: - A histogram with fragment length is computed. - The evaluation of percentage of reads to chrM or MT is computed. @@ -29,5 +33,4 @@ You can have more information about ATAC-seq analysis in the [slides](https://tr ### Warning -- The coverage output is not normalized. - The `reference_genome` parameter value is used to select references in bowtie2 and bedtools slopbed. Only references that are present in bowtie2 **and** bedtools slopbed are selectable. If your favorite reference genome is not available ask your administrator to make sure that each bowtie2 reference has a corresponding len file for use in bedtools slopbed. From 55452e8ea5546ab3d21d78c8ecb370ff796d948b Mon Sep 17 00:00:00 2001 From: Lucille Delisle Date: Thu, 31 Aug 2023 11:00:48 +0200 Subject: [PATCH 15/20] update workflow and tests --- .../epigenetics/atacseq/atacseq-tests.yml | 19 +- workflows/epigenetics/atacseq/atacseq.ga | 539 ++++++++++++++---- 2 files changed, 450 insertions(+), 108 deletions(-) diff --git a/workflows/epigenetics/atacseq/atacseq-tests.yml b/workflows/epigenetics/atacseq/atacseq-tests.yml index 628d01d6d..b1e1aa18b 100644 --- a/workflows/epigenetics/atacseq/atacseq-tests.yml +++ b/workflows/epigenetics/atacseq/atacseq-tests.yml @@ -17,7 +17,8 @@ location: https://zenodo.org/record/3862793/files/SRR891268_chr22_enriched_R2.fastq.gz filetype: fastqsanger reference_genome: hg19 - effective_genome_size: '2700000000' + effective_genome_size: 2700000000 + bin_size: 1000 outputs: mapping stats: element_tests: @@ -82,6 +83,20 @@ asserts: has_line: line: "10167" + bigwig_norm: + element_tests: + SRR891268_chr22_enriched: + asserts: + has_size: + value: 1130014 + delta: 100000 + bigwig_norm2: + element_tests: + SRR891268_chr22_enriched: + asserts: + has_size: + value: 1133795 + delta: 100000 'MultiQC on input dataset(s): Stats': element_tests: bowtie2: @@ -91,7 +106,7 @@ cutadapt: asserts: has_line: - line: "SRR891268_chr22_enriched_2\t4.0\t285247\t41011\t40415\t4283\t280964\t28524700\t480633\t27163516\t4.771948521807416" + line: "SRR891268_chr22_enriched_2\t4.4\t285247\t41011\t40415\t4283\t280964\t28524700\t480633\t27163516\t4.771948521807416" general_stats: asserts: has_text: diff --git a/workflows/epigenetics/atacseq/atacseq.ga b/workflows/epigenetics/atacseq/atacseq.ga index 731cfb15c..9c1b8c3c1 100644 --- a/workflows/epigenetics/atacseq/atacseq.ga +++ b/workflows/epigenetics/atacseq/atacseq.ga @@ -1,6 +1,6 @@ { "a_galaxy_workflow": "true", - "annotation": "This workflow take as input a collection of paired fastq. It will remove bad quality and adapters with cutadapt. Map with Bowtie2 end-to-end. Will remove reads on MT and unconcordant pairs and pairs with mapping quality below 30 and PCR duplicates. Will compute the pile-up on 5' +- 100bp. Will call peaks and count the number of reads falling in the 1kb region centered on the summit. Will plot the number of reads for each fragment length.", + "annotation": "This workflow takes as input a collection of paired fastq. It will remove bad quality and adapters with cutadapt. Map with Bowtie2 end-to-end. Will remove reads on MT and unconcordant pairs and pairs with mapping quality below 30 and PCR duplicates. Will compute the pile-up on 5' +- 100bp. Will call peaks and count the number of reads falling in the 1kb region centered on the summit. Will compute 2 normalization for coverage: normalized by million reads and normalized by million reads in peaks. Will plot the number of reads for each fragment length.", "creator": [ { "class": "Person", @@ -10,7 +10,7 @@ ], "format-version": "0.1", "license": "MIT", - "release": "0.6", + "release": "0.5", "name": "ATACseq", "steps": { "0": { @@ -95,10 +95,37 @@ "workflow_outputs": [] }, "3": { + "annotation": "Bin size for normalized bigwig (usually 50bp is sufficient)", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "Bin size for normalized bigwig (usually 50bp is sufficient)", + "name": "bin_size" + } + ], + "label": "bin_size", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 155.54247082439377, + "top": 898.8496207394044 + }, + "tool_id": null, + "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "942c77e6-f462-49ac-87ed-6e4e14589b0b", + "when": null, + "workflow_outputs": [] + }, + "4": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "errors": null, - "id": 3, + "id": 4, "input_connections": { "library|input_1": { "id": 0, @@ -155,14 +182,14 @@ "when": null, "workflow_outputs": [] }, - "4": { + "6": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.0+galaxy0", "errors": null, - "id": 4, + "id": 6, "input_connections": { "library|input_1": { - "id": 3, + "id": 5, "output_name": "out_pairs" }, "reference_genome|index": { @@ -215,7 +242,7 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"--very-sensitive\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false, \"paired_options\": {\"paired_options_selector\": \"no\", \"__current_case__\": 1}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"--very-sensitive\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false, \"paired_options\": {\"paired_options_selector\": \"no\", \"__current_case__\": 1}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.5.0+galaxy0", "type": "tool", "uuid": "c32a3847-f673-487f-af98-8d50999f2d21", @@ -228,14 +255,14 @@ } ] }, - "5": { + "6": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.2+galaxy1", "errors": null, - "id": 5, + "id": 6, "input_connections": { "input_bam": { - "id": 4, + "id": 5, "output_name": "output" } }, @@ -289,14 +316,14 @@ "when": null, "workflow_outputs": [] }, - "6": { + "7": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_idxstats/samtools_idxstats/2.0.4", "errors": null, - "id": 6, + "id": 7, "input_connections": { "input": { - "id": 4, + "id": 5, "output_name": "output" } }, @@ -334,14 +361,14 @@ "when": null, "workflow_outputs": [] }, - "7": { + "8": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4", "errors": null, - "id": 7, + "id": 8, "input_connections": { "inputFile": { - "id": 5, + "id": 6, "output_name": "out_file1" } }, @@ -403,14 +430,14 @@ } ] }, - "8": { + "9": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", "errors": null, - "id": 8, + "id": 9, "input_connections": { "infile": { - "id": 6, + "id": 7, "output_name": "output" } }, @@ -436,7 +463,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", "tool_shed_repository": { - "changeset_revision": "d698c222f354", + "changeset_revision": "ddf54b12c295", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -448,14 +475,14 @@ "when": null, "workflow_outputs": [] }, - "9": { + "10": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2", "errors": null, - "id": 9, + "id": 10, "input_connections": { "input": { - "id": 7, + "id": 8, "output_name": "outFile" } }, @@ -493,21 +520,21 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"ed_score\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"split\": false, \"tag\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"ed_score\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"split\": false, \"tag\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.30.0+galaxy2", "type": "tool", "uuid": "12ca18f2-222b-4e9c-8ae0-b5772cd51bd7", "when": null, "workflow_outputs": [] }, - "10": { + "11": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pe_histogram/pe_histogram/1.0.1", "errors": null, - "id": 10, + "id": 11, "input_connections": { "input_bam": { - "id": 7, + "id": 8, "output_name": "outFile" } }, @@ -562,14 +589,14 @@ } ] }, - "11": { + "12": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy0", "errors": null, - "id": 11, + "id": 12, "input_connections": { "input": { - "id": 7, + "id": 8, "output_name": "outFile" } }, @@ -583,8 +610,8 @@ } ], "position": { - "left": 2588.4666748046875, - "top": 794.7999877929688 + "left": 1960.1157004761121, + "top": 545.8157628477595 }, "post_job_actions": { "HideDatasetActionoutputcnt": { @@ -607,18 +634,18 @@ "when": null, "workflow_outputs": [] }, - "12": { + "13": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.7.1+galaxy0", "errors": null, - "id": 12, + "id": 13, "input_connections": { "effective_genome_size_options|gsize": { "id": 2, "output_name": "output" }, "treatment|input_treatment_file": { - "id": 9, + "id": 10, "output_name": "output" } }, @@ -737,18 +764,110 @@ } ] }, - "13": { + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "errors": null, + "id": 14, + "input_connections": { + "input": { + "id": 12, + "output_name": "outputcnt" + } + }, + "inputs": [], + "label": "compute 1/million reads", + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1882.2595065493163, + "top": 1417.980906371871 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "tool_shed_repository": { + "changeset_revision": "6595517c2dd8", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": true, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"1/c1\", \"add_column\": {\"mode\": \"R\", \"__current_case__\": 2, \"pos\": \"1\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0", + "type": "tool", + "uuid": "ec62cddf-fb04-4185-b9f4-709de2ce0202", + "when": null, + "workflow_outputs": [] + }, + "15": { + "annotation": "", + "content_id": "wig_to_bigWig", + "errors": null, + "id": 15, + "input_connections": { + "input1": { + "id": 13, + "output_name": "output_treat_pileup" + } + }, + "inputs": [], + "label": "Bigwig from MACS2 (no norm)", + "name": "Wig/BedGraph-to-bigWig", + "outputs": [ + { + "name": "out_file1", + "type": "bigwig" + } + ], + "position": { + "left": 1441.7520678548017, + "top": 1553.245007008225 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Coverage from MACS2 (bigwig)" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wig_to_bigWig", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.1", + "type": "tool", + "uuid": "4eea632c-ec31-43e7-88d2-79895b764a06", + "when": null, + "workflow_outputs": [ + { + "label": "Coverage from MACS2 (bigwig)", + "output_name": "out_file1", + "uuid": "5ffc5c02-8669-49b2-82a1-682ec3122d39" + } + ] + }, + "16": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_slopbed/2.30.0+galaxy1", "errors": null, - "id": 13, + "id": 16, "input_connections": { "genome_file_opts|genome": { "id": 1, "output_name": "output" }, "inputA": { - "id": 12, + "id": 13, "output_name": "output_summits" } }, @@ -793,14 +912,14 @@ "when": null, "workflow_outputs": [] }, - "14": { + "17": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", "errors": null, - "id": 14, + "id": 17, "input_connections": { "infile": { - "id": 12, + "id": 13, "output_name": "output_tabular" } }, @@ -835,7 +954,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", "tool_shed_repository": { - "changeset_revision": "d698c222f354", + "changeset_revision": "ddf54b12c295", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -853,61 +972,53 @@ } ] }, - "15": { + "18": { "annotation": "", - "content_id": "wig_to_bigWig", + "content_id": "param_value_from_file", "errors": null, - "id": 15, + "id": 18, "input_connections": { "input1": { - "id": 12, - "output_name": "output_treat_pileup" + "id": 14, + "output_name": "out_file1" } }, "inputs": [], - "label": "Bigwig from MACS2", - "name": "Wig/BedGraph-to-bigWig", + "label": "Convert 1/million reads to parameter", + "name": "Parse parameter value", "outputs": [ { - "name": "out_file1", - "type": "bigwig" + "name": "text_param", + "type": "expression.json" } ], "position": { - "left": 2183.4166870117188, - "top": 396.51666259765625 + "left": 2130.8390654133264, + "top": 1440.01484113331 }, "post_job_actions": { - "RenameDatasetActionout_file1": { - "action_arguments": { - "newname": "Coverage from MACS2 (bigwig)" - }, - "action_type": "RenameDatasetAction", - "output_name": "out_file1" + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" } }, - "tool_id": "wig_to_bigWig", - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.1", + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", "type": "tool", - "uuid": "c2c4f5aa-1b0d-4801-bc23-8ebdaa3ac176", + "uuid": "7afe5b18-2555-4f24-a1e2-348341631008", "when": null, - "workflow_outputs": [ - { - "label": "Coverage from MACS2 (bigwig)", - "output_name": "out_file1", - "uuid": "c7e35571-ef0a-4e58-9364-a48abe4c0435" - } - ] + "workflow_outputs": [] }, - "16": { + "19": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.30.0", "errors": null, - "id": 16, + "id": 19, "input_connections": { "input": { - "id": 13, + "id": 16, "output_name": "output" } }, @@ -935,7 +1046,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.30.0", "tool_shed_repository": { - "changeset_revision": "a1a923cd89e8", + "changeset_revision": "fe5b4cb8356c", "name": "bedtools", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -953,18 +1064,84 @@ } ] }, - "17": { + "20": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.2+galaxy0", + "errors": null, + "id": 20, + "input_connections": { + "advancedOpt|binSize": { + "id": 3, + "output_name": "output" + }, + "advancedOpt|scaleFactors": { + "id": 18, + "output_name": "text_param" + }, + "bigwigs": { + "id": 15, + "output_name": "out_file1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool bigwigAverage", + "name": "advancedOpt" + } + ], + "label": "normalize by million reads", + "name": "bigwigAverage", + "outputs": [ + { + "name": "outFileName", + "type": "bigwig" + } + ], + "position": { + "left": 2394.696221186954, + "top": 1367.5056983565069 + }, + "post_job_actions": { + "RenameDatasetActionoutFileName": { + "action_arguments": { + "newname": "bigwig normalized per million reads" + }, + "action_type": "RenameDatasetAction", + "output_name": "outFileName" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.2+galaxy0", + "tool_shed_repository": { + "changeset_revision": "f6f246438eda", + "name": "deeptools_bigwig_average", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"yes\", \"__current_case__\": 1, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"skipNAs\": false, \"scaleFactors\": {\"__class__\": \"ConnectedValue\"}, \"blackListFileName\": {\"__class__\": \"RuntimeValue\"}}, \"bigwigs\": {\"__class__\": \"ConnectedValue\"}, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.5.2+galaxy0", + "type": "tool", + "uuid": "fa2633cf-af38-43eb-8c9f-b8b656d6a631", + "when": null, + "workflow_outputs": [ + { + "label": "bigwig_norm", + "output_name": "outFileName", + "uuid": "42fb26ba-7428-43cf-8668-e865b67c12bc" + } + ] + }, + "21": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0+galaxy1", "errors": null, - "id": 17, + "id": 21, "input_connections": { "inputA": { - "id": 16, + "id": 19, "output_name": "output" }, "reduce_or_iterate|inputB": { - "id": 7, + "id": 8, "output_name": "outFile" } }, @@ -1009,14 +1186,14 @@ "when": null, "workflow_outputs": [] }, - "18": { + "22": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", "errors": null, - "id": 18, + "id": 22, "input_connections": { "infile": { - "id": 17, + "id": 21, "output_name": "output" } }, @@ -1051,7 +1228,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", "tool_shed_repository": { - "changeset_revision": "d698c222f354", + "changeset_revision": "ddf54b12c295", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -1069,18 +1246,63 @@ } ] }, - "19": { + "23": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "errors": null, + "id": 23, + "input_connections": { + "input": { + "id": 22, + "output_name": "outfile" + } + }, + "inputs": [], + "label": "compute 1/million reads in peaks", + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1884.0994594973222, + "top": 1705.217377312037 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "tool_shed_repository": { + "changeset_revision": "6595517c2dd8", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": true, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"1/c1\", \"add_column\": {\"mode\": \"R\", \"__current_case__\": 2, \"pos\": \"1\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0", + "type": "tool", + "uuid": "5f55e258-a4fe-4b51-ab9b-2a6f0f22d910", + "when": null, + "workflow_outputs": [] + }, + "24": { "annotation": "", "content_id": "cat1", "errors": null, - "id": 19, + "id": 24, "input_connections": { "input1": { - "id": 18, + "id": 22, "output_name": "outfile" }, "queries_0|input2": { - "id": 11, + "id": 12, "output_name": "outputcnt" } }, @@ -1112,14 +1334,53 @@ "when": null, "workflow_outputs": [] }, - "20": { + "25": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 25, + "input_connections": { + "input1": { + "id": 23, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Convert 1/million reads in peaks to parameter", + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 2129.4511889916307, + "top": 1716.3512055667484 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "f0eb1323-041b-4e29-9f07-de15427c267d", + "when": null, + "workflow_outputs": [] + }, + "26": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", "errors": null, - "id": 20, + "id": 26, "input_connections": { "infile": { - "id": 19, + "id": 24, "output_name": "out_file1" } }, @@ -1145,7 +1406,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", "tool_shed_repository": { - "changeset_revision": "d698c222f354", + "changeset_revision": "ddf54b12c295", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -1157,38 +1418,104 @@ "when": null, "workflow_outputs": [] }, - "21": { + "27": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.2+galaxy0", + "errors": null, + "id": 27, + "input_connections": { + "advancedOpt|binSize": { + "id": 3, + "output_name": "output" + }, + "advancedOpt|scaleFactors": { + "id": 25, + "output_name": "text_param" + }, + "bigwigs": { + "id": 15, + "output_name": "out_file1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool bigwigAverage", + "name": "advancedOpt" + } + ], + "label": "normalize by million reads in peaks", + "name": "bigwigAverage", + "outputs": [ + { + "name": "outFileName", + "type": "bigwig" + } + ], + "position": { + "left": 2402.456534423419, + "top": 1734.6798994525739 + }, + "post_job_actions": { + "RenameDatasetActionoutFileName": { + "action_arguments": { + "newname": "bigwig normalized per million reads in peaks" + }, + "action_type": "RenameDatasetAction", + "output_name": "outFileName" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.2+galaxy0", + "tool_shed_repository": { + "changeset_revision": "f6f246438eda", + "name": "deeptools_bigwig_average", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"yes\", \"__current_case__\": 1, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"skipNAs\": false, \"scaleFactors\": {\"__class__\": \"ConnectedValue\"}, \"blackListFileName\": {\"__class__\": \"RuntimeValue\"}}, \"bigwigs\": {\"__class__\": \"ConnectedValue\"}, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.5.2+galaxy0", + "type": "tool", + "uuid": "8eab7f49-605b-462a-9806-da0c795117f3", + "when": null, + "workflow_outputs": [ + { + "label": "bigwig_norm2", + "output_name": "outFileName", + "uuid": "60031333-7419-4121-a0c7-e235b70a5cfc" + } + ] + }, + "28": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", "errors": null, - "id": 21, + "id": 28, "input_connections": { "results_0|software_cond|input": { - "id": 3, + "id": 4, "output_name": "report" }, "results_1|software_cond|input": { - "id": 4, + "id": 5, "output_name": "mapping_stats" }, "results_2|software_cond|input": { - "id": 8, + "id": 9, "output_name": "outfile" }, "results_3|software_cond|output_0|input": { - "id": 7, + "id": 8, "output_name": "metrics_file" }, "results_4|software_cond|input": { - "id": 10, + "id": 11, "output_name": "output2" }, "results_5|software_cond|input": { - "id": 12, + "id": 13, "output_name": "output_tabular" }, "results_6|software_cond|input": { - "id": 20, + "id": 26, "output_name": "outfile" } }, @@ -1233,15 +1560,15 @@ "uuid": "112d720f-c747-4c92-985f-ebdb52086cc9", "when": null, "workflow_outputs": [ - { - "label": "MultiQC on input dataset(s): Stats", - "output_name": "stats", - "uuid": "6071150d-48db-4cf8-bfed-2cbdb2635856" - }, { "label": "MultiQC webpage", "output_name": "html_report", "uuid": "c22aafb2-d9f2-43c3-a6c4-cfe4a3166c07" + }, + { + "label": "MultiQC on input dataset(s): Stats", + "output_name": "stats", + "uuid": "6071150d-48db-4cf8-bfed-2cbdb2635856" } ] } @@ -1249,6 +1576,6 @@ "tags": [ "ATACseq" ], - "uuid": "eb8e9537-3716-43ea-8e07-afb56a7865cb", - "version": 25 + "uuid": "b052b3a8-b25b-4559-9679-9d030bc124ed", + "version": 1 } \ No newline at end of file From 1f024c5bafc4c0d6b12f5044f4e8df8724932681 Mon Sep 17 00:00:00 2001 From: Lucille Delisle Date: Thu, 31 Aug 2023 11:22:05 +0200 Subject: [PATCH 16/20] reimport workflow --- workflows/epigenetics/atacseq/atacseq.ga | 110 +++++++++++------------ 1 file changed, 55 insertions(+), 55 deletions(-) diff --git a/workflows/epigenetics/atacseq/atacseq.ga b/workflows/epigenetics/atacseq/atacseq.ga index 9c1b8c3c1..ef0a6e0a6 100644 --- a/workflows/epigenetics/atacseq/atacseq.ga +++ b/workflows/epigenetics/atacseq/atacseq.ga @@ -810,57 +810,10 @@ "workflow_outputs": [] }, "15": { - "annotation": "", - "content_id": "wig_to_bigWig", - "errors": null, - "id": 15, - "input_connections": { - "input1": { - "id": 13, - "output_name": "output_treat_pileup" - } - }, - "inputs": [], - "label": "Bigwig from MACS2 (no norm)", - "name": "Wig/BedGraph-to-bigWig", - "outputs": [ - { - "name": "out_file1", - "type": "bigwig" - } - ], - "position": { - "left": 1441.7520678548017, - "top": 1553.245007008225 - }, - "post_job_actions": { - "RenameDatasetActionout_file1": { - "action_arguments": { - "newname": "Coverage from MACS2 (bigwig)" - }, - "action_type": "RenameDatasetAction", - "output_name": "out_file1" - } - }, - "tool_id": "wig_to_bigWig", - "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.1", - "type": "tool", - "uuid": "4eea632c-ec31-43e7-88d2-79895b764a06", - "when": null, - "workflow_outputs": [ - { - "label": "Coverage from MACS2 (bigwig)", - "output_name": "out_file1", - "uuid": "5ffc5c02-8669-49b2-82a1-682ec3122d39" - } - ] - }, - "16": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_slopbed/2.30.0+galaxy1", "errors": null, - "id": 16, + "id": 15, "input_connections": { "genome_file_opts|genome": { "id": 1, @@ -912,11 +865,11 @@ "when": null, "workflow_outputs": [] }, - "17": { + "16": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", "errors": null, - "id": 17, + "id": 16, "input_connections": { "infile": { "id": 13, @@ -972,6 +925,53 @@ } ] }, + "17": { + "annotation": "", + "content_id": "wig_to_bigWig", + "errors": null, + "id": 17, + "input_connections": { + "input1": { + "id": 13, + "output_name": "output_treat_pileup" + } + }, + "inputs": [], + "label": "Bigwig from MACS2 (no norm)", + "name": "Wig/BedGraph-to-bigWig", + "outputs": [ + { + "name": "out_file1", + "type": "bigwig" + } + ], + "position": { + "left": 1589.2888356291103, + "top": 1523.0499864237377 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Coverage from MACS2 (bigwig)" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wig_to_bigWig", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.1", + "type": "tool", + "uuid": "4eea632c-ec31-43e7-88d2-79895b764a06", + "when": null, + "workflow_outputs": [ + { + "label": "Coverage from MACS2 (bigwig)", + "output_name": "out_file1", + "uuid": "5ffc5c02-8669-49b2-82a1-682ec3122d39" + } + ] + }, "18": { "annotation": "", "content_id": "param_value_from_file", @@ -1018,7 +1018,7 @@ "id": 19, "input_connections": { "input": { - "id": 16, + "id": 15, "output_name": "output" } }, @@ -1079,7 +1079,7 @@ "output_name": "text_param" }, "bigwigs": { - "id": 15, + "id": 17, "output_name": "out_file1" } }, @@ -1433,7 +1433,7 @@ "output_name": "text_param" }, "bigwigs": { - "id": 15, + "id": 17, "output_name": "out_file1" } }, @@ -1576,6 +1576,6 @@ "tags": [ "ATACseq" ], - "uuid": "b052b3a8-b25b-4559-9679-9d030bc124ed", - "version": 1 + "uuid": "30cc6ca0-ae12-4f38-8933-77f7cdb35457", + "version": 3 } \ No newline at end of file From cde406fc68690e1a29be37c3aa6286d13a14d238 Mon Sep 17 00:00:00 2001 From: Lucille Delisle Date: Thu, 31 Aug 2023 11:38:50 +0200 Subject: [PATCH 17/20] fix bowtie2 step --- workflows/epigenetics/atacseq/atacseq.ga | 10 +++++----- 1 file changed, 5 insertions(+), 5 deletions(-) diff --git a/workflows/epigenetics/atacseq/atacseq.ga b/workflows/epigenetics/atacseq/atacseq.ga index ef0a6e0a6..0e731852c 100644 --- a/workflows/epigenetics/atacseq/atacseq.ga +++ b/workflows/epigenetics/atacseq/atacseq.ga @@ -182,14 +182,14 @@ "when": null, "workflow_outputs": [] }, - "6": { + "5": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.0+galaxy0", "errors": null, - "id": 6, + "id": 5, "input_connections": { "library|input_1": { - "id": 5, + "id": 4, "output_name": "out_pairs" }, "reference_genome|index": { @@ -1576,6 +1576,6 @@ "tags": [ "ATACseq" ], - "uuid": "30cc6ca0-ae12-4f38-8933-77f7cdb35457", - "version": 3 + "uuid": "267a6009-2a4a-4c69-869c-739894a55a70", + "version": 4 } \ No newline at end of file From 52437b6bbd0e8a3eace18861249eb3a2db5175e6 Mon Sep 17 00:00:00 2001 From: Lucille Delisle Date: Thu, 31 Aug 2023 15:10:46 +0200 Subject: [PATCH 18/20] add normalization option --- workflows/epigenetics/cutandrun/CHANGELOG.md | 6 +- workflows/epigenetics/cutandrun/README.md | 7 +- .../epigenetics/cutandrun/cutandrun-tests.yml | 2 + workflows/epigenetics/cutandrun/cutandrun.ga | 130 +++++++++++------- 4 files changed, 92 insertions(+), 53 deletions(-) diff --git a/workflows/epigenetics/cutandrun/CHANGELOG.md b/workflows/epigenetics/cutandrun/CHANGELOG.md index d5d4e008e..0e455bd33 100644 --- a/workflows/epigenetics/cutandrun/CHANGELOG.md +++ b/workflows/epigenetics/cutandrun/CHANGELOG.md @@ -3,7 +3,11 @@ ## [0.4] 2023-03-17 ### Automatic update -- `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicatesWithMateCigar/2.18.2.3` +- `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4` +- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0` + +### Manual update +- New parameter to get normalized profile ## [0.3] 2022-12-17 diff --git a/workflows/epigenetics/cutandrun/README.md b/workflows/epigenetics/cutandrun/README.md index cc9c9c9e7..f66e16744 100644 --- a/workflows/epigenetics/cutandrun/README.md +++ b/workflows/epigenetics/cutandrun/README.md @@ -9,6 +9,7 @@ - adapter sequences: this depends on the library preparation. Usually CUT&RUN is Truseq and CUT&TAG is Nextera. If you don't know, use FastQC to determine if it is Truseq or Nextera - reference_genome: this field will be adapted to the genomes available for bowtie2 - effective_genome_size: this is used by macs2 and may be entered manually (indications are provided for heavily used genomes) +- normalize_profile: Whether you want to have a profile normalized as Signal to Million Reads. ## Processing @@ -17,10 +18,6 @@ - The BAM is filtered to keep only MAPQ30 and concordant pairs - The PCR duplicates are removed with Picard - The BAM is converted to BED to enable macs2 to take both pairs into account -- The peaks are called with macs2 which at the same time generates a coverage file. +- The peaks are called with macs2 which at the same time generates a coverage file (normalized or not). - The coverage file is converted to bigwig - A multiQC is run to have an overview of the QC - -### Warning - -- The coverage output is not normalized. diff --git a/workflows/epigenetics/cutandrun/cutandrun-tests.yml b/workflows/epigenetics/cutandrun/cutandrun-tests.yml index ce9c33165..e592278d1 100644 --- a/workflows/epigenetics/cutandrun/cutandrun-tests.yml +++ b/workflows/epigenetics/cutandrun/cutandrun-tests.yml @@ -20,6 +20,7 @@ adapter_reverse: 'GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT' reference_genome: 'hg38canon' effective_genome_size: 2700000000 + normalize_profile: false outputs: Mapping stats: element_tests: @@ -82,6 +83,7 @@ adapter_reverse: 'GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT' reference_genome: 'dm6' effective_genome_size: 120000000 + normalize_profile: true outputs: Mapping stats: element_tests: diff --git a/workflows/epigenetics/cutandrun/cutandrun.ga b/workflows/epigenetics/cutandrun/cutandrun.ga index e057bfba3..bd16aa668 100644 --- a/workflows/epigenetics/cutandrun/cutandrun.ga +++ b/workflows/epigenetics/cutandrun/cutandrun.ga @@ -10,7 +10,7 @@ ], "format-version": "0.1", "license": "MIT", - "release": "0.5", + "release": "0.4", "name": "CUTandRUN", "steps": { "0": { @@ -149,10 +149,37 @@ "workflow_outputs": [] }, "5": { + "annotation": "Whether you want to have a profile normalized as Signal to Million Reads", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "Whether you want to have a profile normalized as Signal to Million Reads", + "name": "normalize_profile" + } + ], + "label": "normalize_profile", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 228, + "top": 780.4016399999857 + }, + "tool_id": null, + "tool_state": "{\"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "a2c8d3e2-7542-4feb-8523-6100983ddb3b", + "when": null, + "workflow_outputs": [] + }, + "6": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0", "errors": null, - "id": 5, + "id": 6, "input_connections": { "library|input_1": { "id": 0, @@ -210,21 +237,21 @@ "owner": "lparsons", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": \" \", \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For TrueSeq (CUT and RUN): GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC \", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": [], \"cut\": \"0\"}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source2\": {\"adapter_source_list2\": \"user\", \"__current_case__\": 0, \"adapter_name2\": \"Please use: For R2: - For TruSeq (CUT and RUN): GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTGACGCTGCCGACGA\", \"adapter2\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters2\": [], \"anywhere_adapters2\": [], \"cut2\": \"0\", \"quality_cutoff2\": \"\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": \" \", \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For TrueSeq (CUT and RUN): GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC \", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": [], \"cut\": \"0\"}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source2\": {\"adapter_source_list2\": \"user\", \"__current_case__\": 0, \"adapter_name2\": \"Please use: For R2: - For TruSeq (CUT and RUN): GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTGACGCTGCCGACGA\", \"adapter2\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters2\": [], \"anywhere_adapters2\": [], \"cut2\": \"0\", \"quality_cutoff2\": \"\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"30\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "4.4+galaxy0", "type": "tool", "uuid": "774b0604-628f-46a1-9088-a59d082e5317", "when": null, "workflow_outputs": [] }, - "6": { + "7": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.0+galaxy0", "errors": null, - "id": 6, + "id": 7, "input_connections": { "library|input_1": { - "id": 5, + "id": 6, "output_name": "out_pairs" }, "reference_genome|index": { @@ -277,7 +304,7 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"--very-sensitive\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false, \"paired_options\": {\"paired_options_selector\": \"yes\", \"__current_case__\": 0, \"I\": \"0\", \"X\": \"1000\", \"fr_rf_ff\": \"--fr\", \"no_mixed\": false, \"no_discordant\": false, \"dovetail\": true, \"no_contain\": false, \"no_overlap\": false}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"--very-sensitive\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false, \"paired_options\": {\"paired_options_selector\": \"yes\", \"__current_case__\": 0, \"I\": \"0\", \"X\": \"1000\", \"fr_rf_ff\": \"--fr\", \"no_mixed\": false, \"no_discordant\": false, \"dovetail\": true, \"no_contain\": false, \"no_overlap\": false}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.5.0+galaxy0", "type": "tool", "uuid": "407d46cc-d908-44eb-a4dd-125537498b17", @@ -290,14 +317,14 @@ } ] }, - "7": { + "8": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtool_filter2/samtool_filter2/1.8+galaxy1", "errors": null, - "id": 7, + "id": 8, "input_connections": { "input1": { - "id": 6, + "id": 7, "output_name": "output" } }, @@ -347,14 +374,14 @@ "when": null, "workflow_outputs": [] }, - "8": { + "9": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4", "errors": null, - "id": 8, + "id": 9, "input_connections": { "inputFile": { - "id": 7, + "id": 8, "output_name": "output1" } }, @@ -404,26 +431,26 @@ "uuid": "7f78ad5a-5250-4ced-aa7f-cf0802051c82", "when": null, "workflow_outputs": [ - { - "label": "MarkDuplicates metrics", - "output_name": "metrics_file", - "uuid": "3cec58d5-3851-4ccb-bab5-ae3f550df1e5" - }, { "label": "BAM filtered rmDup", "output_name": "outFile", "uuid": "4cb5b980-39bd-40ab-ad0a-8c90beffd11c" + }, + { + "label": "MarkDuplicates metrics", + "output_name": "metrics_file", + "uuid": "3cec58d5-3851-4ccb-bab5-ae3f550df1e5" } ] }, - "9": { + "10": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2", "errors": null, - "id": 9, + "id": 10, "input_connections": { "input": { - "id": 8, + "id": 9, "output_name": "outFile" } }, @@ -461,29 +488,38 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"ed_score\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"split\": false, \"tag\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"ed_score\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"split\": false, \"tag\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.30.0+galaxy2", "type": "tool", "uuid": "f447290b-bd3d-403d-bc67-0765124b7a97", "when": null, "workflow_outputs": [] }, - "10": { + "11": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.7.1+galaxy0", "errors": null, - "id": 10, + "id": 11, "input_connections": { + "advanced_options|spmr": { + "id": 5, + "output_name": "output" + }, "effective_genome_size_options|gsize": { "id": 4, "output_name": "output" }, "treatment|input_treatment_file": { - "id": 9, + "id": 10, "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool MACS2 callpeak", + "name": "treatment" + } + ], "label": "Call Peaks with MACS2", "name": "MACS2 callpeak", "outputs": [ @@ -575,7 +611,7 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": false, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"all\", \"__current_case__\": 2}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BED\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"-100\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": {\"__class__\": \"ConnectedValue\"}, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"all\", \"__current_case__\": 2}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BED\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"-100\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"RuntimeValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_version": "2.2.7.1+galaxy0", "type": "tool", "uuid": "1a6316d7-3ee1-482a-9264-77bc98090d73", @@ -598,14 +634,14 @@ } ] }, - "11": { + "12": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", "errors": null, - "id": 11, + "id": 12, "input_connections": { "infile": { - "id": 10, + "id": 11, "output_name": "output_tabular" } }, @@ -640,7 +676,7 @@ }, "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", "tool_shed_repository": { - "changeset_revision": "d698c222f354", + "changeset_revision": "ddf54b12c295", "name": "text_processing", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -658,14 +694,14 @@ } ] }, - "12": { + "13": { "annotation": "", "content_id": "wig_to_bigWig", "errors": null, - "id": 12, + "id": 13, "input_connections": { "input1": { - "id": 10, + "id": 11, "output_name": "output_treat_pileup" } }, @@ -705,26 +741,26 @@ } ] }, - "13": { + "14": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", "errors": null, - "id": 13, + "id": 14, "input_connections": { "results_0|software_cond|input": { - "id": 5, + "id": 6, "output_name": "report" }, "results_1|software_cond|input": { - "id": 6, + "id": 7, "output_name": "mapping_stats" }, "results_2|software_cond|output_0|input": { - "id": 8, + "id": 9, "output_name": "metrics_file" }, "results_3|software_cond|input": { - "id": 10, + "id": 11, "output_name": "output_tabular" } }, @@ -769,15 +805,15 @@ "uuid": "0edf5e04-cc38-414c-9b57-117e919c435b", "when": null, "workflow_outputs": [ - { - "label": "MultiQC webpage", - "output_name": "html_report", - "uuid": "6d87436a-550e-4d76-a5da-d4463dfd4473" - }, { "label": "MultiQC on input dataset(s): Stats", "output_name": "stats", "uuid": "59dfba75-8658-4213-8fd9-b3ce5a916f14" + }, + { + "label": "MultiQC webpage", + "output_name": "html_report", + "uuid": "6d87436a-550e-4d76-a5da-d4463dfd4473" } ] } @@ -785,6 +821,6 @@ "tags": [ "CUTnRUN" ], - "uuid": "de155358-1b05-49ea-8740-0e22b5609a67", - "version": 6 + "uuid": "8bbc053c-7565-49d8-bad4-3a16f6c98590", + "version": 2 } \ No newline at end of file From 5d8b7c26b1b7da059b8d187e60f09fd931208fba Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Fri, 1 Sep 2023 10:55:01 +0200 Subject: [PATCH 19/20] Test against release 23.1 --- .github/workflows/workflow_test.yml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/.github/workflows/workflow_test.yml b/.github/workflows/workflow_test.yml index 0adb35dca..fe9956275 100644 --- a/.github/workflows/workflow_test.yml +++ b/.github/workflows/workflow_test.yml @@ -11,7 +11,7 @@ jobs: with: python-version-list: "[\"3.7\"]" galaxy-fork: galaxyproject - galaxy-branch: release_22.05 + galaxy-branch: release_23.1 max-chunks: 4 # Planemo lint the changed repositories @@ -57,7 +57,7 @@ jobs: python-version-list: "[\"3.7\"]" repository-list: ${{ needs.setup.outputs.repository-list }} galaxy-fork: galaxyproject - galaxy-branch: master + galaxy-branch: release_23.1 check-outputs: false combine_outputs: From 3caa9ee51097285e8ef9ac636fbf25685a7f0f6f Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Fri, 1 Sep 2023 10:56:40 +0200 Subject: [PATCH 20/20] Also target periodic tests against 23.1 --- workflows/wftest.yml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/workflows/wftest.yml b/workflows/wftest.yml index 6bb2104ee..1344d7ae3 100644 --- a/workflows/wftest.yml +++ b/workflows/wftest.yml @@ -10,7 +10,7 @@ jobs: with: python-version-list: "[\"3.7\"]" galaxy-fork: galaxyproject - galaxy-branch: master + galaxy-branch: release_23.1 test: name: Test workflow needs: setup @@ -19,6 +19,6 @@ jobs: galaxy-head-sha: ${{ needs.setup.outputs.galaxy-head-sha }} python-version-list: "[\"3.7\"]" galaxy-fork: galaxyproject - galaxy-branch: master + galaxy-branch: release_23.1 repository-list: '.' check-outputs: true