Problem with degenerate primers

[LunavdL]

Hi,

I have a dataset with 11 indices and the following degenerative primers:
Forward: TGAAACAGAAMAWCGTCATTATGC
Reverse: CCTTCNCGAATMGCRAAWCGC

I notice that my "_unk" files are quite large, whereas some of the sample files contain hardly any sequences at all.
If I take a look at the content of the "unk" files, I actually think there are sequences in there that should have been assigned to samples.
For example the following sequence, with the index in [brackets]:
[CGACGGTTAGATTCACCTCTTACA]TGAAACAGAACATCGTCATTATGC
The C matches the M and the T matches the W of the primer.
The index+primer are within the first 150 bp (the search length I assigned with -l).

I know that the description says that primer sequences can also contain Y, R, W, S, M, K or N. But I wonder if my missing sequences could have to do with the degenerate primers?

Best,
Luna